Comparative protein modelling by satisfaction of spatial restraints.
We describe a comparative protein modelling technique designed to search out essentially the most possible construction for a sequence given its alignment with associated buildings. The three-dimensional (3D) mannequin is obtained by optimally satisfying spatial restraints derived from the alignment and expressed as chance density capabilities (pdfs) for the options restrained.
For instance, the chances for main-chain conformations of a modelled residue could also be restrained by its residue kind, main-chain conformation of an equal residue in a associated protein, and the native similarity between the 2 sequences. A number of such pdfs are obtained from the correlations between structural options in 17 households of homologous proteins which have been aligned on the premise of their 3D constructions.
Prion Protein (PRNP) Antibody
|
The pdfs restrain C alpha-C alpha distances, main-chain N-O distances, main-chain and side-chain dihedral angles. A smoothing process is used within the derivation of those relationships to reduce the issue of a sparse database. The 3D mannequin of a protein is obtained by optimization of the molecular pdf such that the mannequin violates the enter restraints as little as potential.
The molecular pdf is derived as a mix of pdfs restraining particular person spatial options of the entire molecule. The optimization process is a variable goal operate technique that applies the conjugate gradients algorithm to positions of all non-hydrogen atoms. The strategy is automated and is illustrated by the modelling of trypsin from two different serine proteinases.

stat-2
PRNP Antibody, HRP conjugated
|
Objective: Study demographics, scientific traits, estimated incapacity, laboratory outcomes, and treatment responses of a U.S. MOGAD cohort with age- and sex-matched MS and NMO victims.
Design, setting, and people: This observational, case-control, single-center study acknowledged each group by way of ICD-10 evaluation code searches by the electronic medical info of grownup victims seen on the John L. Trotter MS Coronary heart between January 1, 2019 and January 1, 2020. MOGAD and NMO victims have been confirmed to have a minimal of 1 constructive antibody verify; these inside the MS group had a confirmed evaluation by a physician with MS subspecialty teaching. Data have been collected after IRB approval.
Outcomes: Twenty-six victims have been included in each group. MOGAD victims have been predominantly Caucasian (88.5%) with suggest onset age of 43.9 years. MOGAD victims had no comorbid totally different autoimmune illnesses and comparatively lower expenses of family members with autoimmune sickness (20.0%) than each MS (40.0%) or NMO (34.6%) matched cohorts.
91% of MOGAD assaults have been monofocal, and over 70% provided with optic neuritis. Severity of MOGAD assaults was very similar to that of seropositive NMO, nonetheless the sturdy diploma of restoration was additional very similar to MS. four MOGAD victims remodeled to opposed antibody standing, with no assaults occurring after conversion.
Prnp Polyclonal Antibody, FITC Conjugated
|
Serum ANA and ENA have been a lot much less incessantly elevated in MOGAD (21.7%, 5.0%) than in seropositive NMO victims (66.7%, 42.9%). Elevated IgG synthesis charge and constructive CSF-restricted oligoclonal bands weren’t seen in our MOGAD cohort, and only one MOGAD affected particular person had an elevated IgG index. No matter anti-CD20 treatment, 28.6% of MOGAD victims continued to endure relapses.
Conclusions: MOGAD was characterised by a predominantly monofocal presentation (often optic neuritis) and excessive assaults with larger restoration than seen with seropositive NMO assaults. Lack of CSF-restricted oligoclonal bands distinguished MOGAD from MS.
Little is known regarding the B cells and antigen receptors stimulated by the novel human coronavirus SARS-CoV-2. Proper right here we current that the human B cell compartment in victims with diagnostically confirmed SARS-CoV-2 and scientific COVID-19 is rapidly altered with the early recruitment of B cells expressing a restricted subset of V genes, and intensive activation of IgG and IgA subclasses with out necessary somatic mutation.
Main Prion Protein (PRNP) Antibody (HRP)
|
All through virus an an infection B cells are essential for the manufacturing of antibodies and defending immunity. Establishment of a numerous antibody repertoire occurs by rearrangement of germline DNA on the immunoglobulin heavy and light-weight chain loci to encode the membrane-bound kind of antibodies, the B cell antigen receptor.
We detect development of B cell clones along with convergent antibodies with extraordinarily comparable sequences all through SARS-CoV-2 victims, highlighting stereotyped naïve responses to this virus. A shared convergent B cell clonotype in SARS-CoV-2 contaminated victims was beforehand seen in victims with SARS.
These findings present molecular insights into shared choices of human B cell responses to SARS-CoV-2 and totally different zoonotic spillover coronaviruses.
Description: The proteasome is a multicatalytic proteinase superior with a extraordinarily ordered ring-shaped 20S core development. The core development consists of 4 rings of 28 non-identical subunits; 2 rings are composed of seven alpha subunits and a few rings are composed of seven beta subunits. Proteasomes are distributed all by way of eukaryotic cells at a extreme focus and cleave peptides in an ATP/ubiquitin-dependent course of in a non-lysosomal pathway.
An necessary function of a modified proteasome, the immunoproteasome, is the processing of sophistication I MHC peptides. This gene encodes a member of the proteasome B-type family, usually often called the T1B family, that could be a 20S core beta subunit.
This gene is positioned inside the class II space of the MHC (primary histocompatibility superior). Expression of this gene is induced by gamma interferon and this gene product replaces catalytic subunit 3 (proteasome beta 5 subunit) inside the immunoproteasome.
Proteolytic processing is required to generate a mature subunit. Two totally different transcripts encoding two isoforms have been acknowledged; every isoforms are processed to yield the similar mature subunit.
Human Prion Protein (PRNP) ELISA Kit |
DLR-PRNP-Hu-96T |
DL Develop |
96T |
EUR 647.00 |
- Should the Human Prion Protein (PRNP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Prion Protein (PRNP) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Prion Protein (PRNP) ELISA Kit |
DLR-PRNP-Mu-48T |
DL Develop |
48T |
EUR 508.00 |
- Should the Mouse Prion Protein (PRNP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Prion Protein (PRNP) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Prion Protein (PRNP) ELISA Kit |
DLR-PRNP-Mu-96T |
DL Develop |
96T |
EUR 661.00 |
- Should the Mouse Prion Protein (PRNP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Prion Protein (PRNP) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Prion Protein (PRNP) ELISA Kit |
RD-PRNP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500.00 |
Human Prion Protein (PRNP) ELISA Kit |
RD-PRNP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692.00 |
Mouse Prion Protein (PRNP) ELISA Kit |
RD-PRNP-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511.00 |
Mouse Prion Protein (PRNP) ELISA Kit |
RD-PRNP-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709.00 |
Human Prion Protein (PRNP) ELISA Kit |
RDR-PRNP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522.00 |
Human Prion Protein (PRNP) ELISA Kit |
RDR-PRNP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724.00 |
Mouse Prion Protein (PRNP) ELISA Kit |
RDR-PRNP-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 534.00 |
Mouse Prion Protein (PRNP) ELISA Kit |
RDR-PRNP-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 742.00 |
PRNP siRNA |
20-abx904256 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PRNP siRNA |
20-abx929861 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PRNP siRNA |
20-abx929862 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PRNP Antibody |
43022-100ul |
SAB |
100ul |
EUR 252.00 |
PRNP Antibody |
32732-100ul |
SAB |
100ul |
EUR 252.00 |
PRNP antibody |
70R-19541 |
Fitzgerald |
50 ul |
EUR 435.00 |
Description: Rabbit polyclonal PRNP antibody |
PRNP antibody |
70R-14331 |
Fitzgerald |
100 ug |
EUR 322.00 |
Description: Affinity purified Rabbit polyclonal PRNP antibody |
PRNP antibody |
70R-14332 |
Fitzgerald |
100 ug |
EUR 322.00 |
Description: Affinity purified Rabbit polyclonal PRNP antibody |
PRNP Antibody |
DF7034 |
Affbiotech |
200ul |
EUR 304.00 |
Description: PRNP Antibody detects endogenous levels of total PRNP. |
PRNP Antibody |
1-CSB-PA018739GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against PRNP. Recognizes PRNP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
PRNP Antibody |
1-CSB-PA018739LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PRNP. Recognizes PRNP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
Prnp Antibody |
1-CSB-PA018739LA01RA |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Prnp. Recognizes Prnp from Rat. This antibody is Unconjugated. Tested in the following application: ELISA |
PRNP Conjugated Antibody |
C43022 |
SAB |
100ul |
EUR 397.00 |
PRNP Conjugated Antibody |
C32732 |
SAB |
100ul |
EUR 397.00 |
PRNP cloning plasmid |
CSB-CL018739HU1-10ug |
Cusabio |
10ug |
EUR 233.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 762
- Sequence: atggcgaaccttggctgctggatgctggttctctttgtggccacatggagtgacctgggcctctgcaagaagcgcccgaagcctggaggatggaacactgggggcagccgatacccggggcagggcagccctggaggcaaccgctacccacctcagggcggtggtggctgggggca
- Show more
|
Description: A cloning plasmid for the PRNP gene. |
PRNP cloning plasmid |
CSB-CL018739HU2-10ug |
Cusabio |
10ug |
EUR 233.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 762
- Sequence: atggcgaaccttggctgctggatgctggttctctttgtggccacatggagtgacctgggcctctgcaagaagcgcccgaagcctggaggatggaacactgggggcagccgatacccggggcagggcagccctggaggcaaccgctacccacctcagggcggtggtggctgggggca
- Show more
|
Description: A cloning plasmid for the PRNP gene. |
Prnp Polyclonal Antibody |
A63226 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
PRNP Rabbit pAb |
A2583-100ul |
Abclonal |
100 ul |
EUR 308.00 |
PRNP Rabbit pAb |
A2583-200ul |
Abclonal |
200 ul |
EUR 459.00 |
PRNP Rabbit pAb |
A2583-20ul |
Abclonal |
20 ul |
EUR 183.00 |
PRNP Rabbit pAb |
A2583-50ul |
Abclonal |
50 ul |
EUR 223.00 |
PRNP Blocking Peptide |
DF7034-BP |
Affbiotech |
1mg |
EUR 195.00 |
Anti-PRNP antibody |
STJ11100031 |
St John's Laboratory |
100 µl |
EUR 413.00 |
Description: The protein encoded by this gene is a membrane glycosylphosphatidylinositol-anchored glycoprotein that tends to aggregate into rod-like structures. The encoded protein contains a highly unstable region of five tandem octapeptide repeats. This gene is found on chromosome 20, approximately 20 kbp upstream of a gene which encodes a biochemically and structurally similar protein to the one encoded by this gene. Mutations in the repeat region as well as elsewhere in this gene have been associated with Creutzfeldt-Jakob disease, fatal familial insomnia, Gerstmann-Straussler disease, Huntington disease-like 1, and kuru. An overlapping open reading frame has been found for this gene that encodes a smaller, structurally unrelated protein, AltPrp. Alternative splicing results in multiple transcript variants. |
Anti-PRNP antibody |
STJ25153 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: The protein encoded by this gene is a membrane glycosylphosphatidylinositol-anchored glycoprotein that tends to aggregate into rod-like structures. The encoded protein contains a highly unstable region of five tandem octapeptide repeats. This gene is found on chromosome 20, approximately 20 kbp upstream of a gene which encodes a biochemically and structurally similar protein to the one encoded by this gene. Mutations in the repeat region as well as elsewhere in this gene have been associated with Creutzfeldt-Jakob disease, fatal familial insomnia, Gerstmann-Straussler disease, Huntington disease-like 1, and kuru. An overlapping open reading frame has been found for this gene that encodes a smaller, structurally unrelated protein, AltPrp. Alternative splicing results in multiple transcript variants. |
Rat PRNP shRNA Plasmid |
20-abx984602 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Prion Protein (PRNP) Antibody |
20-abx114678 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Prion Protein (PRNP) Antibody |
abx120079-01ml |
Abbexa |
0.1 ml |
EUR 1483.00 |
- Shipped within 5-10 working days.
|
Prion Protein (PRNP) Antibody |
20-abx101113 |
Abbexa |
- EUR 411.00
- EUR 133.00
- EUR 1149.00
- EUR 565.00
- EUR 314.00
|
|
- Shipped within 5-7 working days.
|
Prion Protein (PRNP) Antibody |
20-abx101114 |
Abbexa |
- EUR 425.00
- EUR 133.00
- EUR 1177.00
- EUR 578.00
- EUR 328.00
|
|
- Shipped within 5-7 working days.
|
Prion Protein (PRNP) Antibody |
20-abx174157 |
Abbexa |
|
|
|
Prion Protein (PRNP) Antibody |
abx431521-200ul |
Abbexa |
200 ul |
EUR 384.00 |
- Shipped within 1-3 working days.
|
Human PRNP shRNA Plasmid |
20-abx953788 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PRNP protein (His tag) |
80R-2717 |
Fitzgerald |
20 ug |
EUR 322.00 |
Description: Purified recombinant PRNP protein (His tag) |
Mouse PRNP shRNA Plasmid |
20-abx972213 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PRNP Antibody, HRP conjugated |
1-CSB-PA018739LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PRNP. Recognizes PRNP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
Prnp Antibody, HRP conjugated |
1-CSB-PA018739LB01RA |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Prnp. Recognizes Prnp from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA |
PRNP Antibody, FITC conjugated |
1-CSB-PA018739LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PRNP. Recognizes PRNP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
Prnp Antibody, FITC conjugated |
1-CSB-PA018739LC01RA |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Prnp. Recognizes Prnp from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA |
PRNP Antibody, Biotin conjugated |
1-CSB-PA018739LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PRNP. Recognizes PRNP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Prnp Antibody, Biotin conjugated |
1-CSB-PA018739LD01RA |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Prnp. Recognizes Prnp from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Recombinant Prion Protein (PRNP) |
4-RPB680Hu01 |
Cloud-Clone |
- EUR 490.66
- EUR 234.00
- EUR 1564.96
- EUR 588.32
- EUR 1076.64
- EUR 391.00
- EUR 3762.40
|
|
- Uniprot ID: P04156
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 26.6kDa
- Isoelectric Point: 9.5
|
Description: Recombinant Human Prion Protein expressed in: E.coli |
Recombinant Prion Protein (PRNP) |
4-RPB680Mu01 |
Cloud-Clone |
- EUR 512.16
- EUR 240.00
- EUR 1645.60
- EUR 615.20
- EUR 1130.40
- EUR 406.00
- EUR 3964.00
|
|
- Uniprot ID: P04925
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 26.8kDa
- Isoelectric Point: 9.6
|
Description: Recombinant Mouse Prion Protein expressed in: E.coli |
PRNP Recombinant Protein (Human) |
RP024679 |
ABM |
100 ug |
Ask for price |
PRNP Recombinant Protein (Human) |
RP024682 |
ABM |
100 ug |
Ask for price |
PRNP Recombinant Protein (Rat) |
RP222233 |
ABM |
100 ug |
Ask for price |
PRNP Recombinant Protein (Mouse) |
RP164672 |
ABM |
100 ug |
Ask for price |
Mouse Prion Protein (PRNP) Protein |
20-abx068666 |
Abbexa |
- EUR 718.00
- EUR 286.00
- EUR 2221.00
- EUR 857.00
- EUR 509.00
|
|
- Shipped within 5-7 working days.
|
Human Prion Protein (PRNP) Protein |
20-abx068667 |
Abbexa |
- EUR 690.00
- EUR 286.00
- EUR 2110.00
- EUR 815.00
- EUR 495.00
|
|
- Shipped within 5-7 working days.
|
Major Prion Protein (PRNP) Antibody |
20-abx002019 |
Abbexa |
- EUR 411.00
- EUR 592.00
- EUR 182.00
- EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Major Prion Protein (PRNP) Antibody |
20-abx319681 |
Abbexa |
- EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Prion Protein (PRNP) Antibody Pair |
20-abx370619 |
Abbexa |
|
|
- Shipped within 5-15 working days.
|
Prion Protein (PRNP) Antibody Pair |
20-abx370620 |
Abbexa |
|
|
- Shipped within 5-15 working days.
|
Prion Protein (PRNP) Antibody Pair |
20-abx370621 |
Abbexa |
|
|
- Shipped within 5-15 working days.
|
Major Prion Protein (PRNP) Antibody |
20-abx333875 |
Abbexa |
- EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Major Prion Protein (PRNP) Protein |
20-abx263341 |
Abbexa |
- EUR 1609.00
- EUR 328.00
- EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Prnp Polyclonal Antibody, HRP Conjugated |
A63227 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
Prnp Polyclonal Antibody, FITC Conjugated |
A63228 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Prnp Polyclonal Antibody, Biotin Conjugated |
A63229 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
[KO Validated] PRNP Rabbit pAb |
A18058-100ul |
Abclonal |
100 ul |
EUR 410.00 |
[KO Validated] PRNP Rabbit pAb |
A18058-200ul |
Abclonal |
200 ul |
EUR 571.00 |
[KO Validated] PRNP Rabbit pAb |
A18058-20ul |
Abclonal |
20 ul |
EUR 221.00 |
[KO Validated] PRNP Rabbit pAb |
A18058-50ul |
Abclonal |
50 ul |
EUR 287.00 |
Rat Major prion protein (Prnp) |
1-CSB-YP018739RA |
Cusabio |
- EUR 504.00
- EUR 265.00
- EUR 1832.00
- EUR 763.00
- EUR 1216.00
- EUR 334.00
|
|
- MW: 24.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Rat Major prion protein(Prnp) expressed in Yeast |
Rat Major prion protein (Prnp) |
1-CSB-EP018739RA |
Cusabio |
- EUR 505.00
- EUR 265.00
- EUR 1827.00
- EUR 766.00
- EUR 1218.00
- EUR 335.00
|
|
- MW: 26.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Rat Major prion protein(Prnp) expressed in E.coli |
PRNP ORF Vector (Human) (pORF) |
ORF008227 |
ABM |
1.0 ug DNA |
EUR 95.00 |
PRNP ORF Vector (Human) (pORF) |
ORF008228 |
ABM |
1.0 ug DNA |
EUR 95.00 |
Prnp ORF Vector (Rat) (pORF) |
ORF074079 |
ABM |
1.0 ug DNA |
EUR 506.00 |
Prnp ORF Vector (Mouse) (pORF) |
ORF054892 |
ABM |
1.0 ug DNA |
EUR 506.00 |
PRNP ELISA Kit (Human) (OKAN05977) |
OKAN05977 |
Aviva Systems Biology |
96 Wells |
EUR 792.00 |
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.059 ng/mL |
PRNP ELISA Kit (Mouse) (OKAN05979) |
OKAN05979 |
Aviva Systems Biology |
96 Wells |
EUR 792.00 |
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.058 ng/mL |
PRNP ELISA Kit (Human) (OKCD07577) |
OKCD07577 |
Aviva Systems Biology |
96 Wells |
EUR 936.00 |
Description: Description of target: The protein encoded by this gene is a membrane glycosylphosphatidylinositol-anchored glycoprotein that tends to aggregate into rod-like structures. The encoded protein contains a highly unstable region of five tandem octapeptide repeats. This gene is found on chromosome 20, approximately 20 kbp upstream of a gene which encodes a biochemically and structurally similar protein to the one encoded by this gene. Mutations in the repeat region as well as elsewhere in this gene have been associated with Creutzfeldt-Jakob disease, fatal familial insomnia, Gerstmann-Straussler disease, Huntington disease-like 1, and kuru. An overlapping open reading frame has been found for this gene that encodes a smaller, structurally unrelated protein, AltPrp. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL |
PRNP ELISA Kit (Mouse) (OKCD07578) |
OKCD07578 |
Aviva Systems Biology |
96 Wells |
EUR 818.00 |
Description: Description of target: Prnp may play a role in neuronal development and synaptic plasticity, may be required for neuronal myelin sheath maintenance and may play a role in iron uptake and iron homeostasis. Prnp is a soluble oligomers are toxic to cultured neuroblastoma cells and induce apoptosis (in vitro). Association with GPC1 (via its heparan sulfate chains) targets PRNP to lipid rafts. It also provides Cu2+ or ZN2+ for the ascorbate-mediated GPC1 deaminase degradation of its heparan sulfate side chains.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL |
PRNP ELISA Kit (Rat) (OKCA01901) |
OKCA01901 |
Aviva Systems Biology |
96 Wells |
EUR 846.00 |
Description: Description of target: Its primary physiological function is unclear. Has cytoprotective activity against internal or environmental stresses. May play a role in neuronal development and synaptic plasticity. May be required for neuronal myelin sheath maintenance. May play a role in iron uptake and iron homeostasis. Soluble oligomers are toxic to cultured neuroblastoma cells and induce apoptosis (in vitro). Association with GPC1 (via its heparan sulfate chains) targets PRNP to lipid rafts. Also provides Cu2+ or ZN2+ for the ascorbate-mediated GPC1 deaminase degradation of its heparan sulfate side chains.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.078 ng/mL |
PRNP ELISA Kit (Rat) (OKEH05953) |
OKEH05953 |
Aviva Systems Biology |
96 Wells |
EUR 818.00 |
Description: Description of target: Its primary physiological function is unclear. May play a role in neuronal development and synaptic plasticity. May be required for neuronal myelin sheath maintenance. May promote myelin homeostasis through acting as a agonist for ADGRG6 receptor. May play a role in iron uptake and iron homeostasis. Soluble oligomers are toxic to cultured neuroblastoma cells and induce apoptosis (in vitro). Association with GPC1 (via its heparan sulfate chains) targets PRNP to lipid rafts. Also provides Cu2+ or ZN2+ for the ascorbate-mediated GPC1 deaminase degradation of its heparan sulfate side chains.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.177 ng/mL |
PRNP ELISA Kit (Bovine) (OKEH08763) |
OKEH08763 |
Aviva Systems Biology |
96 Wells |
EUR 1092.00 |
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.075 ng/mL |
PRNP ELISA Kit (Chicken) (OKEH08764) |
OKEH08764 |
Aviva Systems Biology |
96 Wells |
EUR 1184.00 |
Description: Description of target: This gene encodes a membrane glycosylphosphatidylinositol-anchored glycoprotein found in the central nervous system. In human and other vertebrates, the homologous protein is associated with neurodegenerative diseases that result from improper protein metabolism.;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.095ng/mL |
PRNP ELISA Kit (Dog) (OKEH08765) |
OKEH08765 |
Aviva Systems Biology |
96 Wells |
EUR 1184.00 |
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
Introduction: Monoclonal antibodies (mAbs) have flip into an rising provide of natural cures. Clinicians should make an effort to exchange their info on mechanisms of movement, indications and antagonistic events of these novel therapies. Most of them have immunosuppressive outcomes and, subsequently, vaccination is indicated.
Areas lined: vaccination of victims beneath mAbs therapies.
Skilled opinion: Ideas on vaccination are nonetheless based on educated solutions and have not been updated these days. Specific solutions for each mAb have not been addressed inside the current literature.
The aim of this entire evaluation was to assemble the entire therapeutic mAbs authorised as a lot as January 1, 2020 and, based on earlier solutions and the pharmaceutical traits of each drug, to counsel an updated info with solutions on vaccination.
Influenza, sequential pneumococcal and Hepatitis B vaccination in victims with opposed serology have been the one fixed solutions.
Hepatitis A vaccination was proposed for mAbs with explicit hepatotoxic traits. Totally different vaccines are reviewed and talked about. Numerous non-immunosuppressive mAbs have been detected and, subsequently, vaccinations not advisable. We hope that this evaluation can operate a kick off point for compiling updated vaccination solutions and accumulating the entire therapeutic mAbs authorised as a lot as 2020.
Key phrases: biologic treatment; biologics; immunosuppression; mAbs; monoclonal antibodies; vaccine; vaccine time.
superior publicity histories and immune mediated interactions between influenza strains contribute to the life course of human immunity to influenza. Antibody profiles may be generated by characterizing immune responses to a lot of antigenically variant strains, nonetheless how these profiles differ all through folks and resolve future responses is unclear.
We used hemagglutination inhibition titers from 21 H3N2 strains to assemble 777 paired antibody profiles from people aged 2 to 86, and developed novel metrics to grab choices of these profiles. Complete antibody titer per potential influenza publicity will enhance in adolescence, then decreases in middle age.
Elevated titers to a lot of strains have been seen in 97.8% of people all through a roughly four-year interval, suggesting widespread influenza publicity.
Bovine Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
DLR-a1AGP-b-96T |
DL Develop |
96T |
EUR 715.00 |
- Should the Bovine Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Alpha-1-Acid Glycoprotein (a1AGP) in samples from serum, plasma, urine or other biological fluids. |
Human Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
DLR-a1AGP-Hu-48T |
DL Develop |
48T |
EUR 479.00 |
- Should the Human Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Alpha-1-Acid Glycoprotein (a1AGP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
DLR-a1AGP-Hu-96T |
DL Develop |
96T |
EUR 621.00 |
- Should the Human Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Alpha-1-Acid Glycoprotein (a1AGP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
DLR-a1AGP-Mu-48T |
DL Develop |
48T |
EUR 489.00 |
- Should the Mouse Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Alpha-1-Acid Glycoprotein (a1AGP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
DLR-a1AGP-Mu-96T |
DL Develop |
96T |
EUR 635.00 |
- Should the Mouse Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Alpha-1-Acid Glycoprotein (a1AGP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Porcine Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
DLR-a1AGP-p-48T |
DL Develop |
48T |
EUR 547.00 |
- Should the Porcine Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Alpha-1-Acid Glycoprotein (a1AGP) in samples from serum, plasma or other biological fluids. |
Porcine Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
DLR-a1AGP-p-96T |
DL Develop |
96T |
EUR 715.00 |
- Should the Porcine Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Alpha-1-Acid Glycoprotein (a1AGP) in samples from serum, plasma or other biological fluids. |
Bovine Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
RD-a1AGP-b-48Tests |
Reddot Biotech |
48 Tests |
EUR 555.00 |
Bovine Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
RD-a1AGP-b-96Tests |
Reddot Biotech |
96 Tests |
EUR 771.00 |
Human Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
RD-a1AGP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478.00 |
Human Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
RD-a1AGP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662.00 |
Mouse Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
RD-a1AGP-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489.00 |
Mouse Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
RD-a1AGP-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677.00 |
Porcine Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
RD-a1AGP-p-48Tests |
Reddot Biotech |
48 Tests |
EUR 555.00 |
Porcine Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
RD-a1AGP-p-96Tests |
Reddot Biotech |
96 Tests |
EUR 771.00 |
Bovine Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
RDR-a1AGP-b-48Tests |
Reddot Biotech |
48 Tests |
EUR 580.00 |
Bovine Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
RDR-a1AGP-b-96Tests |
Reddot Biotech |
96 Tests |
EUR 807.00 |
Human Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
RDR-a1AGP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500.00 |
Human Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
RDR-a1AGP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692.00 |
Mouse Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
RDR-a1AGP-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511.00 |
Mouse Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
RDR-a1AGP-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709.00 |
Porcine Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
RDR-a1AGP-p-48Tests |
Reddot Biotech |
48 Tests |
EUR 580.00 |
Porcine Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
RDR-a1AGP-p-96Tests |
Reddot Biotech |
96 Tests |
EUR 807.00 |
A1AGP ELISA Kit (Pig) (OKCD04398) |
OKCD04398 |
Aviva Systems Biology |
96 Wells |
EUR 936.00 |
Description: Description of target: ;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.19 ng/mL |
Alpha-1-Acid Glycoprotein (a1AGP) Antibody |
20-abx129955 |
Abbexa |
- EUR 453.00
- EUR 133.00
- EUR 1288.00
- EUR 620.00
- EUR 342.00
|
|
- Shipped within 5-7 working days.
|
Alpha-1-Acid Glycoprotein (a1AGP) Antibody |
20-abx130174 |
Abbexa |
- EUR 425.00
- EUR 133.00
- EUR 1177.00
- EUR 578.00
- EUR 328.00
|
|
- Shipped within 5-7 working days.
|
Alpha-1-Acid Glycoprotein (a1AGP) Antibody |
20-abx130175 |
Abbexa |
- EUR 425.00
- EUR 133.00
- EUR 1177.00
- EUR 578.00
- EUR 328.00
|
|
- Shipped within 5-7 working days.
|
Alpha-1-Acid Glycoprotein (a1AGP) Antibody |
20-abx171163 |
Abbexa |
|
|
|
Alpha-1-Acid Glycoprotein (a1AGP) Antibody |
20-abx171164 |
Abbexa |
|
|
|
Alpha-1-Acid Glycoprotein (a1AGP) Antibody |
20-abx102589 |
Abbexa |
- EUR 398.00
- EUR 133.00
- EUR 1107.00
- EUR 537.00
- EUR 314.00
|
|
- Shipped within 5-12 working days.
|
Alpha-1-Acid Glycoprotein (a1AGP) Antibody |
20-abx102590 |
Abbexa |
- EUR 411.00
- EUR 133.00
- EUR 1135.00
- EUR 551.00
- EUR 314.00
|
|
- Shipped within 5-12 working days.
|
Alpha-1-Acid Glycoprotein (a1AGP) Antibody |
20-abx102591 |
Abbexa |
- EUR 425.00
- EUR 133.00
- EUR 1177.00
- EUR 578.00
- EUR 328.00
|
|
- Shipped within 5-7 working days.
|
Alpha-1-Acid Glycoprotein (a1AGP) Antibody |
20-abx102592 |
Abbexa |
- EUR 453.00
- EUR 133.00
- EUR 1288.00
- EUR 620.00
- EUR 342.00
|
|
- Shipped within 5-7 working days.
|
Alpha-1-Acid Glycoprotein (a1AGP) Antibody |
20-abx175329 |
Abbexa |
|
|
|
Recombinant Alpha-1-Acid Glycoprotein (a1AGP) |
4-RPA816Bo01 |
Cloud-Clone |
- EUR 530.08
- EUR 245.00
- EUR 1712.80
- EUR 637.60
- EUR 1175.20
- EUR 418.00
- EUR 4132.00
|
|
- Uniprot ID: Q5GN72
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 46.1kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Bovine Alpha-1-Acid Glycoprotein expressed in: E.coli |
Recombinant Alpha-1-Acid Glycoprotein (a1AGP) |
4-RPA816Hu01 |
Cloud-Clone |
- EUR 350.88
- EUR 197.00
- EUR 1040.80
- EUR 413.60
- EUR 727.20
- EUR 298.00
- EUR 2452.00
|
|
- Uniprot ID: P02763
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 23.1kDa
- Isoelectric Point: 5.5
|
Description: Recombinant Human Alpha-1-Acid Glycoprotein expressed in: E.coli |
Recombinant Alpha-1-Acid Glycoprotein (a1AGP) |
4-RPA816Mu01 |
Cloud-Clone |
- EUR 386.72
- EUR 206.00
- EUR 1175.20
- EUR 458.40
- EUR 816.80
- EUR 322.00
- EUR 2788.00
|
|
- Uniprot ID: Q60590
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 23.5kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Alpha-1-Acid Glycoprotein expressed in: E.coli |
Recombinant Alpha-1-Acid Glycoprotein (a1AGP) |
4-RPA816Po01 |
Cloud-Clone |
- EUR 510.37
- EUR 239.00
- EUR 1638.88
- EUR 612.96
- EUR 1125.92
- EUR 404.00
- EUR 3947.20
|
|
- Uniprot ID: Q29014
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 23.6kDa
- Isoelectric Point: 6.7
|
Description: Recombinant Pig Alpha-1-Acid Glycoprotein expressed in: E.coli |
Recombinant Alpha-1-Acid Glycoprotein (a1AGP) |
4-RPA816Ra01 |
Cloud-Clone |
- EUR 512.16
- EUR 240.00
- EUR 1645.60
- EUR 615.20
- EUR 1130.40
- EUR 406.00
- EUR 3964.00
|
|
- Uniprot ID: P02764
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 20.7kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Alpha-1-Acid Glycoprotein expressed in: E.coli |
Recombinant Alpha-1-Acid Glycoprotein (a1AGP) |
4-RPA816Ra02 |
Cloud-Clone |
- EUR 467.36
- EUR 228.00
- EUR 1477.60
- EUR 559.20
- EUR 1018.40
- EUR 376.00
- EUR 3544.00
|
|
- Uniprot ID: P02764
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 51.3kDa
- Isoelectric Point: 5.9
|
Description: Recombinant Rat Alpha-1-Acid Glycoprotein expressed in: E.coli |
Recombinant Alpha-1-Acid Glycoprotein (a1AGP) |
4-RPA816Ra03 |
Cloud-Clone |
- EUR 467.36
- EUR 228.00
- EUR 1477.60
- EUR 559.20
- EUR 1018.40
- EUR 376.00
- EUR 3544.00
|
|
- Uniprot ID: P02764
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 25.0kDa
- Isoelectric Point: 6.4
|
Description: Recombinant Rat Alpha-1-Acid Glycoprotein expressed in: E.coli |
Recombinant Alpha-1-Acid Glycoprotein (a1AGP) |
4-RPA816Rb01 |
Cloud-Clone |
- EUR 548.00
- EUR 250.00
- EUR 1780.00
- EUR 660.00
- EUR 1220.00
- EUR 430.00
- EUR 4300.00
|
|
- Uniprot ID: P25227
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 24.8kDa
- Isoelectric Point: 6.3
|
Description: Recombinant Rabbit Alpha-1-Acid Glycoprotein expressed in: E.coli |
Cow Alpha-1-Acid Glycoprotein (a1AGP) Protein |
20-abx065224 |
Abbexa |
- EUR 732.00
- EUR 286.00
- EUR 2305.00
- EUR 885.00
- EUR 523.00
|
|
- Shipped within 5-12 working days.
|
Human Alpha-1-Acid Glycoprotein (a1AGP) Protein |
20-abx065225 |
Abbexa |
- EUR 495.00
- EUR 244.00
- EUR 1414.00
- EUR 578.00
- EUR 356.00
|
|
- Shipped within 5-7 working days.
|
Mouse Alpha-1-Acid Glycoprotein (a1AGP) Protein |
20-abx065226 |
Abbexa |
- EUR 551.00
- EUR 244.00
- EUR 1595.00
- EUR 648.00
- EUR 411.00
|
|
- Shipped within 5-7 working days.
|
Rat Alpha-1-Acid Glycoprotein (a1AGP) Protein |
20-abx065227 |
Abbexa |
- EUR 648.00
- EUR 272.00
- EUR 1998.00
- EUR 773.00
- EUR 467.00
|
|
- Shipped within 5-12 working days.
|
Rat Alpha-1-Acid Glycoprotein (a1AGP) Protein |
20-abx065228 |
Abbexa |
- EUR 648.00
- EUR 272.00
- EUR 1998.00
- EUR 773.00
- EUR 467.00
|
|
- Shipped within 5-12 working days.
|
Pig Alpha-1-Acid Glycoprotein (a1AGP) Protein |
20-abx167520 |
Abbexa |
- EUR 718.00
- EUR 286.00
- EUR 2207.00
- EUR 843.00
- EUR 509.00
|
|
- Shipped within 5-7 working days.
|
Rabbit Alpha-1-Acid Glycoprotein (a1AGP) Protein |
20-abx167558 |
Abbexa |
- EUR 759.00
- EUR 300.00
- EUR 2388.00
- EUR 913.00
- EUR 537.00
|
|
- Shipped within 5-7 working days.
|
Rat Alpha-1-Acid Glycoprotein (a1AGP) Protein |
20-abx167692 |
Abbexa |
- EUR 718.00
- EUR 286.00
- EUR 2221.00
- EUR 857.00
- EUR 509.00
|
|
- Shipped within 5-7 working days.
|
Alpha-1-Acid Glycoprotein (a1AGP) Antibody (FITC) |
20-abx273970 |
Abbexa |
- EUR 453.00
- EUR 244.00
- EUR 1316.00
- EUR 634.00
- EUR 342.00
|
|
- Shipped within 5-15 working days.
|
Alpha-1-Acid Glycoprotein (a1AGP) Antibody (Biotin) |
20-abx274430 |
Abbexa |
- EUR 356.00
- EUR 203.00
- EUR 926.00
- EUR 467.00
- EUR 300.00
|
|
- Shipped within 5-7 working days.
|
Alpha-1-Acid Glycoprotein (a1AGP) Antibody (Biotin) |
20-abx274528 |
Abbexa |
- EUR 342.00
- EUR 203.00
- EUR 857.00
- EUR 439.00
- EUR 286.00
|
|
- Shipped within 5-7 working days.
|
Alpha-1-Acid Glycoprotein (a1AGP) Antibody Pair |
20-abx370211 |
Abbexa |
|
|
- Shipped within 5-15 working days.
|
Alpha-1-Acid Glycoprotein (a1AGP) Antibody Pair |
20-abx370500 |
Abbexa |
|
|
- Shipped within 5-15 working days.
|
Alpha-1-Acid Glycoprotein (a1AGP) Antibody Pair |
20-abx370608 |
Abbexa |
|
|
- Shipped within 5-12 working days.
|
Alpha-1-Acid Glycoprotein (a1AGP) Antibody Pair |
20-abx370689 |
Abbexa |
|
|
- Shipped within 5-7 working days.
|
Alpha-1-Acid Glycoprotein (a1AGP) Antibody (Biotin) |
20-abx271004 |
Abbexa |
- EUR 453.00
- EUR 244.00
- EUR 1288.00
- EUR 620.00
- EUR 342.00
|
|
- Shipped within 5-15 working days.
|
Alpha-1-Acid Glycoprotein (a1AGP) Antibody (Biotin) |
20-abx271795 |
Abbexa |
- EUR 425.00
- EUR 230.00
- EUR 1191.00
- EUR 578.00
- EUR 328.00
|
|
- Shipped within 5-7 working days.
|
Alpha-1-Acid Glycoprotein (a1AGP) Antibody (Biotin) |
20-abx272601 |
Abbexa |
- EUR 425.00
- EUR 230.00
- EUR 1219.00
- EUR 592.00
- EUR 328.00
|
|
- Shipped within 5-15 working days.
|
Chicken a1AGP(Alpha-1-Acid Glycoprotein) ELISA Kit |
ECH0091 |
FN Test |
96T |
EUR 567.60 |
- Detection range: 6.25-400 ng/ml
- Uniprot ID: Q8JIG5
- Alias: Alpha-1-Acid Glycoprotein
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Chicken;Sensitivity: 3.75 ng/ml |
Mouse Alpha-1-Acid Glycoprotein(a1AGP)ELISA kit |
GA-E0763MS-48T |
GenAsia Biotech |
48T |
EUR 336.00 |
Mouse Alpha-1-Acid Glycoprotein(a1AGP)ELISA kit |
GA-E0763MS-96T |
GenAsia Biotech |
96T |
EUR 534.00 |
Rat Alpha-1-Acid Glycoprotein (a1AGP) CLIA Kit |
abx195068-96tests |
Abbexa |
96 tests |
EUR 825.00 |
- Shipped within 5-12 working days.
|
Alpha-1-Acid Glycoprotein (a1AGP) Monoclonal Antibody (Rat) |
4-MAA816Ra21 |
Cloud-Clone |
- EUR 253.00
- EUR 2615.00
- EUR 649.00
- EUR 319.00
- EUR 217.00
|
|
- Sequence of the immunogen: Asn20~Gln186
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Rat Alpha-1-Acid Glycoprotein (a1AGP) |
Alpha-1-Acid Glycoprotein (a1AGP) Monoclonal Antibody (Rat) |
4-MAA816Ra22 |
Cloud-Clone |
- EUR 253.00
- EUR 2615.00
- EUR 649.00
- EUR 319.00
- EUR 217.00
|
|
- Sequence of the immunogen: Gln19~Gln186
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Rat Alpha-1-Acid Glycoprotein (a1AGP) |
Alpha-1-Acid Glycoprotein (a1AGP) Monoclonal Antibody (Rat) |
4-MAA816Ra24 |
Cloud-Clone |
- EUR 255.00
- EUR 2642.00
- EUR 655.00
- EUR 322.00
- EUR 217.00
|
|
- Sequence of the immunogen: Gln19~Gln186
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Rat Alpha-1-Acid Glycoprotein (a1AGP) |
Alpha-1-Acid Glycoprotein (a1AGP) Monoclonal Antibody (Rat) |
4-MAA816Ra26 |
Cloud-Clone |
- EUR 255.00
- EUR 2642.00
- EUR 655.00
- EUR 322.00
- EUR 217.00
|
|
- Sequence of the immunogen: Gln19~Gln186
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Rat Alpha-1-Acid Glycoprotein (a1AGP) |
Alpha-1-Acid Glycoprotein (a1AGP) Polyclonal Antibody (Bovine) |
4-PAA816Bo01 |
Cloud-Clone |
- EUR 259.00
- EUR 2694.00
- EUR 667.00
- EUR 326.00
- EUR 218.00
|
|
- Sequence of the immunogen: a1AGP (Thr33~Arg195)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Alpha-1-Acid Glycoprotein (a1AGP) |
Alpha-1-Acid Glycoprotein (a1AGP) Polyclonal Antibody (Human) |
4-PAA816Hu01 |
Cloud-Clone |
- EUR 232.00
- EUR 2285.00
- EUR 574.00
- EUR 289.00
- EUR 208.00
|
|
- Sequence of the immunogen: a1AGP (Gln19~Ser201)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Alpha-1-Acid Glycoprotein (a1AGP) |
Alpha-1-Acid Glycoprotein (a1AGP) Polyclonal Antibody (Mouse) |
4-PAA816Mu01 |
Cloud-Clone |
- EUR 236.00
- EUR 2338.00
- EUR 586.00
- EUR 294.00
- EUR 209.00
|
|
- Sequence of the immunogen: a1AGP (Gln19~Ala207)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Alpha-1-Acid Glycoprotein (a1AGP) |
Alpha-1-Acid Glycoprotein (a1AGP) Polyclonal Antibody (Pig) |
4-PAA816Po01 |
Cloud-Clone |
- EUR 259.00
- EUR 2694.00
- EUR 667.00
- EUR 326.00
- EUR 218.00
|
|
- Sequence of the immunogen: a1AGP linked with GKGR(Leu2~Glu171+(GKGR))
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Pig Alpha-1-Acid Glycoprotein (a1AGP) |
Alpha-1-Acid Glycoprotein (a1AGP) Polyclonal Antibody (Rat) |
4-PAA816Ra01 |
Cloud-Clone |
- EUR 243.00
- EUR 2457.00
- EUR 613.00
- EUR 305.00
- EUR 212.00
|
|
- Sequence of the immunogen: a1AGP (Asn20~Gln186)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Alpha-1-Acid Glycoprotein (a1AGP) |
Alpha-1-Acid Glycoprotein (a1AGP) Polyclonal Antibody (Rat) |
4-PAA816Ra02 |
Cloud-Clone |
- EUR 243.00
- EUR 2457.00
- EUR 613.00
- EUR 305.00
- EUR 212.00
|
|
- Sequence of the immunogen: a1AGP (Gln19~Gln186)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Alpha-1-Acid Glycoprotein (a1AGP) |
Alpha-1-Acid Glycoprotein (a1AGP) Polyclonal Antibody (Rat) |
4-PAA816Ra03 |
Cloud-Clone |
- EUR 243.00
- EUR 2457.00
- EUR 613.00
- EUR 305.00
- EUR 212.00
|
|
- Sequence of the immunogen: a1AGP (Gln19~Thr201)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Alpha-1-Acid Glycoprotein (a1AGP) |
Alpha-1-Acid Glycoprotein (a1AGP) Polyclonal Antibody (Rabbit) |
4-PAA816Rb51 |
Cloud-Clone |
- EUR 243.00
- EUR 2450.00
- EUR 611.00
- EUR 304.00
- EUR 212.00
|
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Guinea polyclonal antibody against Rabbit Alpha-1-Acid Glycoprotein (a1AGP) |
Cattle Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
SEA816Bo-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5098.02 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Alpha-1-Acid Glycoprotein (a1AGP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Alpha-1-Acid Glycoprotein (a1AGP) in serum, plasma, urine and other biological fluids. |
Cattle Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
SEA816Bo-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 507.48 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Alpha-1-Acid Glycoprotein (a1AGP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Alpha-1-Acid Glycoprotein (a1AGP) in serum, plasma, urine and other biological fluids. |
Cattle Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
SEA816Bo-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 682.12 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Alpha-1-Acid Glycoprotein (a1AGP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Alpha-1-Acid Glycoprotein (a1AGP) in serum, plasma, urine and other biological fluids. |
Cattle Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
SEA816Bo-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2769.54 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Alpha-1-Acid Glycoprotein (a1AGP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Alpha-1-Acid Glycoprotein (a1AGP) in serum, plasma, urine and other biological fluids. |
Cattle Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
4-SEA816Bo |
Cloud-Clone |
- EUR 5149.00
- EUR 2720.00
- EUR 683.00
|
|
- Known also as Alpha-1-Acid Glycoprotein elisa. Alternative names of the recognized antigen: AGP1
- a1-AGP
- ORM1
- OMD 1
- Orosomucoid 1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Cattle Alpha-1-Acid Glycoprotein (a1AGP) in samples from serum, plasma, urine and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Alpha-1-Acid Glycoprotein (a1AGP) ELISA Kit |
SEA816Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 3409.41 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Alpha-1-Acid Glycoprotein (a1AGP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Alpha-1-Acid Glycoprotein (a1AGP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |