Measurement of protein utilizing bicinchoninic acid.
Bicinchoninic acid, sodium salt, is a steady, water-soluble compound able to forming an intense purple advanced with cuprous ion (Cu1+) in an alkaline setting. This reagent types the idea of an analytical methodology able to monitoring cuprous ion produced within the response of protein with alkaline Cu2+ (biuret response).
The colour produced from this response is steady and will increase in a proportional style over a broad vary of accelerating protein concentrations.
Recombinant Human UPK2 Protein, His, E.coli-5ug
|
When in comparison with the strategy of Lowry et al., the outcomes reported right here show a higher tolerance of the bicinchoninate reagent towards such generally encountered interferences as nonionic detergents and easy buffer salts. The soundness of the reagent and ensuing chromophore additionally permits for a simplified, one-step evaluation and an enhanced flexibility in protocol choice. This new methodology maintains the excessive sensitivity and low protein-to-protein variation related to the Lowry approach.
- After sequence affirmation, it was transformed into E. coli BL21 (DE3) and dealt with with 0.5 mmol/L isopropyl-beta-D-thiogalactopyranoside (IPTG) to induce protein expression.
- We purified and renatured the recombinant PE8 protein, and immunized New Zealand rabbits to prepare the polyclonal antibody. Antibody titer was determined by indirect ELISA and the specificity was evaluated by Western blot analysis.
- Outcomes The recombinant plasmid pET28a-PE8 was effectively constructed, and the PE8 protein was primarily expressed in an inclusion physique in E. coli. After renaturation and purification, a purity of about 90% of the recombinant protein was achieved.
- The titer of the polyclonal antibody was bigger than 1:430 080. The polyclonal antibody may notably acknowledge the recombinant PE8 protein.
- Conclusion We’ve now effectively expressed and purified recombinant PE8 protein, which might be further utilized to generate PE8 polyclonal antibody with acceptable titer and specificity.

stat-2
UPK2 Protein Vector (Human) (pPB-N-His)
|
Rabies is a lethal zoonotic sickness endemic in creating worldwide areas of Asia and Africa. Simply recently, the direct speedy immunohistochemical check out (DRIT) was helpful by the World Nicely being Group (WHO) and the World Group for Animal Nicely being (OIE) as a diagnostic check out for rabies.
Because of this reality, a biotinylated polyclonal antibody (pAb) in the direction of the rabies lyssavirus (RABV) nucleoprotein was developed using a plasmid cDNA vaccine derived from an issue virus customary 11 stress. A preliminary evaluation on the efficacy of this reagent in recognizing the Philippine RABV stress was examined using banked canine hippocampal tissue samples with DRIT and the outcomes had been as compared with dFAT.
The outcomes of acetone and formalin fixation on DRIT had been moreover assessed by way of immunoreactivity scores of the specimens. Of the 142 samples examined, 104 examined optimistic and 38 harmful using every dFAT and DRIT, displaying 100% settlement between the two diagnostic procedures. Moreover, no false optimistic or false harmful outcomes had been observed using acetone and formalin fixation.
Thus, domestically prepared biotinylated pAb from plasmid cDNA may be utilized for DRIT, notably in resource-limited laboratories throughout the Philippines.
Nonetheless, these outcomes should be confirmed with a further thorough evaluation of this methodology, and the fluctuate of detection have to be further evaluated in an even bigger panel of animal samples and on completely different lyssaviruses.
Key phrases: DRIT; Evaluation; Fixation; Immunohistochemistry; Rabies; dFAT.
UPK2 Recombinant Protein (Mouse) |
RP183206 |
ABM |
100 ug |
Ask for price |
UPK2 Uroplakin 2 Human Recombinant Protein |
PROTO00526 |
BosterBio |
Regular: 20ug |
EUR 317.00 |
Description: UPK2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 153 amino acids (26-155 a.a) and having a molecular mass of 16.2kDa.;UPK2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Recombinant Human UPK2 Protein, His, E.coli-1mg |
QP13897-1mg |
EnQuireBio |
1mg |
EUR 2757.00 |
Recombinant Human UPK2 Protein, His, E.coli-20ug |
QP13897-20ug |
EnQuireBio |
20ug |
EUR 201.00 |
Recombinant Human UPK2 Protein, His, E.coli-5ug |
QP13897-5ug |
EnQuireBio |
5ug |
EUR 155.00 |
Recombinant Uroplakin 2 (UPK2) |
4-RPF561Hu01 |
Cloud-Clone |
- EUR 368.80
- EUR 202.00
- EUR 1108.00
- EUR 436.00
- EUR 772.00
- EUR 310.00
- EUR 2620.00
|
|
- Uniprot ID: O00526
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 17.4kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Uroplakin 2 expressed in: E.coli |
Human Uroplakin 2 (UPK2) Protein |
20-abx650668 |
Abbexa |
- EUR 523.00
- EUR 244.00
- EUR 1497.00
- EUR 606.00
- EUR 384.00
|
|
- Shipped within 5-7 working days.
|
UPK2 antibody |
70R-21174 |
Fitzgerald |
50 ul |
EUR 435.00 |
Description: Rabbit polyclonal UPK2 antibody |
UPK2 Antibody |
1-CSB-PA025656GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against UPK2. Recognizes UPK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
UPK2 siRNA |
20-abx939075 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UPK2 protein (His tag) |
30R-2967 |
Fitzgerald |
100 ug |
EUR 322.00 |
Description: Purified recombinant Human UPK2 protein (His tag) |
Uroplakin-2 (UPK2) Protein |
20-abx261408 |
Abbexa |
- EUR 3418.00
- EUR 328.00
- EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Recombinant Human Uroplakin-2/UPK2 (C-6His) |
CA11-10ug |
Novoprotein |
10ug |
EUR 202.00 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4. |
Recombinant Human Uroplakin-2/UPK2 (C-6His) |
CA11-1mg |
Novoprotein |
1mg |
EUR 2283.00 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4. |
Recombinant Human Uroplakin-2/UPK2 (C-6His) |
CA11-500ug |
Novoprotein |
500ug |
EUR 1613.00 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4. |
Recombinant Human Uroplakin-2/UPK2 (C-6His) |
CA11-50ug |
Novoprotein |
50ug |
EUR 496.00 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4. |
Human UPK2 shRNA Plasmid |
20-abx955048 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
UPK2 Polyclonal Antibody |
27504-100ul |
SAB |
100ul |
EUR 252.00 |
UPK2 Polyclonal Antibody |
27504-50ul |
SAB |
50ul |
EUR 187.00 |
UPK2 Rabbit pAb |
A10813-100ul |
Abclonal |
100 ul |
EUR 308.00 |
UPK2 Rabbit pAb |
A10813-200ul |
Abclonal |
200 ul |
EUR 459.00 |
UPK2 Rabbit pAb |
A10813-20ul |
Abclonal |
20 ul |
EUR 183.00 |
UPK2 Rabbit pAb |
A10813-50ul |
Abclonal |
50 ul |
EUR 223.00 |
UPK2 cloning plasmid |
CSB-CL025656HU-10ug |
Cusabio |
10ug |
EUR 233.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 555
- Sequence: ATGGCACCCCTGCTGCCCATCCGGACCTTGCCCTTGATCCTGATTCTGCTGGCTCTGCTGTCCCCAGGGGCTGCAGACTTCAACATCTCAAGCCTCTCTGGTCTGCTGTCCCCGGCACTAACGGAGAGCCTGCTGGTTGCCTTGCCCCCCTGTCACCTCACAGGAGGCAATGCCAC
- Show more
|
Description: A cloning plasmid for the UPK2 gene. |
UPK2 Rabbit pAb |
A3338-100ul |
Abclonal |
100 ul |
EUR 308.00 |
UPK2 Rabbit pAb |
A3338-200ul |
Abclonal |
200 ul |
EUR 459.00 |
UPK2 Rabbit pAb |
A3338-20ul |
Abclonal |
20 ul |
Ask for price |
UPK2 Rabbit pAb |
A3338-50ul |
Abclonal |
50 ul |
Ask for price |
anti- UPK2 antibody |
FNab09274 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:200-1:2000
- IHC:1:20-1:200
- Immunogen: uroplakin 2
- Uniprot ID: O00526
- Gene ID: 7379
- Research Area: Developmental biology
|
Description: Antibody raised against UPK2 |
anti- UPK2 antibody |
FNab09275 |
FN Test |
100µg |
EUR 585.00 |
- Recommended dilution: IHC:1:20-1:200
- Immunogen: uroplakin 2
- Uniprot ID: O00526
- Gene ID: 7379
- Research Area: Developmental biology
|
Description: Antibody raised against UPK2 |
Anti-UPK2 antibody |
STJ26047 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene encodes one of the proteins of the highly conserved urothelium-specific integral membrane proteins of the asymmetric unit membrane which forms urothelium apical plaques in mammals. The asymmetric unit membrane is believed to strengthen the urothelium by preventing cell rupture during bladder distention. The encoded protein is expressed in the peripheral blood of bladder cancer patients with transitional cell carcinomas. |
Anti-UPK2 antibody |
STJ112709 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene encodes one of the proteins of the highly conserved urothelium-specific integral membrane proteins of the asymmetric unit membrane which forms urothelium apical plaques in mammals. The asymmetric unit membrane is believed to strengthen the urothelium by preventing cell rupture during bladder distention. The encoded protein is expressed in the peripheral blood of bladder cancer patients with transitional cell carcinomas. |
UPK2 ORF Vector (Human) (pORF) |
ORF014895 |
ABM |
1.0 ug DNA |
EUR 354.00 |
UPK2 ELISA Kit (Human) (OKAN06386) |
OKAN06386 |
Aviva Systems Biology |
96 Wells |
EUR 792.00 |
Description: Description of target: This gene encodes one of the proteins of the highly conserved urothelium-specific integral membrane proteins of the asymmetric unit membrane which forms urothelium apical plaques in mammals. The asymmetric unit membrane is believed to strengthen the urothelium by preventing cell rupture during bladder distention. The encoded protein is expressed in the peripheral blood of bladder cancer patients with transitional cell carcinomas.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.053 ng/mL |
UPK2 ELISA Kit (Human) (OKCD00470) |
OKCD00470 |
Aviva Systems Biology |
96 Wells |
EUR 831.00 |
Description: Description of target: Component of the asymmetric unit membrane (AUM); a highly specialized biomembrane elaborated by terminally differentiated urothelial cells. May play an important role in regulating the assembly of the AUM (By similarity).By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.053 ng/mL |
UPK2 Protein Vector (Human) (pPB-C-His) |
PV059577 |
ABM |
500 ng |
EUR 481.00 |
UPK2 Protein Vector (Human) (pPB-N-His) |
PV059578 |
ABM |
500 ng |
EUR 481.00 |
UPK2 Protein Vector (Human) (pPM-C-HA) |
PV059579 |
ABM |
500 ng |
EUR 481.00 |
UPK2 Protein Vector (Human) (pPM-C-His) |
PV059580 |
ABM |
500 ng |
EUR 481.00 |
Mouse Uroplakin-2 (Upk2) |
1-CSB-EP025656MO |
Cusabio |
- EUR 505.00
- EUR 265.00
- EUR 1827.00
- EUR 766.00
- EUR 1218.00
- EUR 335.00
|
|
- MW: 40.8 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Uroplakin-2(Upk2) expressed in E.coli |
Uroplakin 2 (UPK2) Antibody |
20-abx116547 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Uroplakin-2 (UPK2) Antibody |
20-abx126762 |
Abbexa |
- EUR 411.00
- EUR 592.00
- EUR 182.00
- EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Uroplakin 2 (UPK2) Antibody |
20-abx131673 |
Abbexa |
- EUR 453.00
- EUR 133.00
- EUR 1302.00
- EUR 620.00
- EUR 342.00
|
|
- Shipped within 5-7 working days.
|
Uroplakin-2 (UPK2) Antibody |
abx239274-100ug |
Abbexa |
100 ug |
EUR 509.00 |
- Shipped within 5-12 working days.
|
UPK2 Polyclonal Conjugated Antibody |
C27504 |
SAB |
100ul |
EUR 397.00 |
Uroplakin-2 (UPK2) Antibody |
20-abx002383 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human Uroplakin 2 (UPK2) ELISA Kit |
20-abx156911 |
Abbexa |
- EUR 7378.00
- EUR 3933.00
- EUR 911.00
|
|
- Shipped within 5-7 working days.
|
Human Uroplakin 2 (UPK2) CLIA Kit |
20-abx494951 |
Abbexa |
- EUR 7973.00
- EUR 4246.00
- EUR 981.00
|
|
|
UPK2 sgRNA CRISPR Lentivector set (Human) |
K2591901 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
Uroplakin 2 (UPK2) Polyclonal Antibody (Human) |
4-PAF561Hu01 |
Cloud-Clone |
- EUR 261.00
- EUR 2734.00
- EUR 676.00
- EUR 330.00
- EUR 220.00
|
|
- Sequence of the immunogen: UPK2 (Asp26~Thr153)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2) |
Human Uroplakin 2 ELISA Kit (UPK2) |
RK02481 |
Abclonal |
96 Tests |
EUR 521.00 |
Human Uroplakin 2 (UPK2) ELISA Kit |
SEF561Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.50 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids. |
Human Uroplakin 2 (UPK2) ELISA Kit |
SEF561Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.30 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids. |
Human Uroplakin 2 (UPK2) ELISA Kit |
SEF561Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639.00 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids. |
Human Uroplakin 2 (UPK2) ELISA Kit |
SEF561Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.50 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids. |
Human Uroplakin 2 (UPK2) ELISA Kit |
4-SEF561Hu |
Cloud-Clone |
- EUR 4782.00
- EUR 2526.00
- EUR 640.00
|
|
- Known also as Uroplakin 2 elisa. Alternative names of the recognized antigen: UPII
- Uroplakin II
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Uroplakin 2 (UPK2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
UPK2 Protein Vector (Mouse) (pPB-C-His) |
PV244278 |
ABM |
500 ng |
EUR 603.00 |
UPK2 Protein Vector (Mouse) (pPB-N-His) |
PV244279 |
ABM |
500 ng |
EUR 603.00 |
UPK2 Protein Vector (Mouse) (pPM-C-HA) |
PV244280 |
ABM |
500 ng |
EUR 603.00 |
UPK2 Protein Vector (Mouse) (pPM-C-His) |
PV244281 |
ABM |
500 ng |
EUR 603.00 |
UPK2 Protein Vector (Rat) (pPB-C-His) |
PV314586 |
ABM |
500 ng |
EUR 603.00 |
UPK2 Protein Vector (Rat) (pPB-N-His) |
PV314587 |
ABM |
500 ng |
EUR 603.00 |
UPK2 Protein Vector (Rat) (pPM-C-HA) |
PV314588 |
ABM |
500 ng |
EUR 603.00 |
UPK2 Protein Vector (Rat) (pPM-C-His) |
PV314589 |
ABM |
500 ng |
EUR 603.00 |
Uroplakin 2 (UPK2) Antibody (Cy3) |
20-abx274287 |
Abbexa |
- EUR 592.00
- EUR 286.00
- EUR 1887.00
- EUR 857.00
- EUR 467.00
|
|
- Shipped within 5-12 working days.
|
Upk2 ORF Vector (Mouse) (pORF) |
ORF061070 |
ABM |
1.0 ug DNA |
EUR 506.00 |
Upk2 ORF Vector (Rat) (pORF) |
ORF078647 |
ABM |
1.0 ug DNA |
EUR 506.00 |
ELISA kit for Human UPK2 (Uroplakin 2) |
ELK5223 |
ELK Biotech |
1 plate of 96 wells |
EUR 432.00 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uroplakin 2 (UPK2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Uroplakin 2 (UP
- Show more
|
Description: A sandwich ELISA kit for detection of Uroplakin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
UPK2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2591902 |
ABM |
1.0 ug DNA |
EUR 154.00 |
UPK2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2591903 |
ABM |
1.0 ug DNA |
EUR 154.00 |
UPK2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2591904 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Uroplakin 2 (UPK2) Polyclonal Antibody (Human), APC |
4-PAF561Hu01-APC |
Cloud-Clone |
- EUR 367.00
- EUR 3581.00
- EUR 989.00
- EUR 470.00
- EUR 228.00
|
|
- Sequence of the immunogen: UPK2 (Asp26~Thr153)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with APC. |
Uroplakin 2 (UPK2) Polyclonal Antibody (Human), Biotinylated |
4-PAF561Hu01-Biotin |
Cloud-Clone |
- EUR 327.00
- EUR 2684.00
- EUR 783.00
- EUR 403.00
- EUR 225.00
|
|
- Sequence of the immunogen: UPK2 (Asp26~Thr153)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with Biotin. |
Uroplakin 2 (UPK2) Polyclonal Antibody (Human), Cy3 |
4-PAF561Hu01-Cy3 |
Cloud-Clone |
- EUR 447.00
- EUR 4733.00
- EUR 1277.00
- EUR 585.00
- EUR 263.00
|
|
- Sequence of the immunogen: UPK2 (Asp26~Thr153)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with Cy3. |
Uroplakin 2 (UPK2) Polyclonal Antibody (Human), FITC |
4-PAF561Hu01-FITC |
Cloud-Clone |
- EUR 313.00
- EUR 2884.00
- EUR 811.00
- EUR 396.00
- EUR 202.00
|
|
- Sequence of the immunogen: UPK2 (Asp26~Thr153)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with FITC. |
Uroplakin 2 (UPK2) Polyclonal Antibody (Human), HRP |
4-PAF561Hu01-HRP |
Cloud-Clone |
- EUR 334.00
- EUR 3120.00
- EUR 873.00
- EUR 424.00
- EUR 214.00
|
|
- Sequence of the immunogen: UPK2 (Asp26~Thr153)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with HRP. |
Uroplakin 2 (UPK2) Polyclonal Antibody (Human), PE |
4-PAF561Hu01-PE |
Cloud-Clone |
- EUR 313.00
- EUR 2884.00
- EUR 811.00
- EUR 396.00
- EUR 202.00
|
|
- Sequence of the immunogen: UPK2 (Asp26~Thr153)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with PE. |
Uroplakin 2 (UPK2) Polyclonal Antibody (Human), APC-Cy7 |
4-PAF561Hu01-APC-Cy7 |
Cloud-Clone |
- EUR 614.00
- EUR 7042.00
- EUR 1858.00
- EUR 821.00
- EUR 337.00
|
|
- Sequence of the immunogen: UPK2 (Asp26~Thr153)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with APC-Cy7. |
AChE (acetylcholinesterase) is generally labeled as a specific biomarker of pesticide publicity. The purpose of this look at was to provide AChE polyclonal antibody from hybrid catfish that had been uncovered to industrial glyphosate.
The hybrid catfish was uncovered to glyphosate (0.75 mL/L) for 24 h. After that, the fish thoughts was dissected, AChE was extracted and purified by hydroxyapatite column chromatography and eluted with 0.2 M potassium phosphate buffer pH 6.8.
Uroplakin 2 (UPK2) (Human), APC
|
- This protocol gave 70% yield. Then, the thoughts extract was characterised using 10% SDS-PAGE and Western blot probed with industrial polyclonal antibody explicit to AChE (PAb-AChE). The protein, 71 kDa, was then used as an antigen to immunize mice for antibody manufacturing.
- The polyclonal antibody (PAb) was characterised using dot blot, Western blot and immunohistochemistry for immunolocalization of AChE in hybrid catfish uncovered to glyphosate. We found that the appropriate dilution of antibody for every dot blot and Western blot was 1:3500, and 1:2500 for immunohistochemistry.
- Cross reactivity testing confirmed that PAb-AChE may be utilized with AChE from striped snakehead fish on the same dilution as used with AChE from hybrid catfish.
- It was concluded that PAb explicit to hybrid catfish AChE from this work was extraordinarily explicit and delicate, and may cross-react with striped snakehead fish AChE.
- Thus, this polyclonal antibody may be utilized in monitoring glyphosate publicity in hybrid catfish and striped snakehead fish.
Key phrases: Acetylcholinesterase (AChE); Biomarker; Glyphosate; Hybrid catfish; Polyclonal antibody (PAb).
Unavailability of antibodies with extreme affinity and specificity within the course of goat αs1-casein hinders the occasion of immuno-based analytical methods equal to enzyme-linked immunosorbent assay (ELISA) and biosensors. Proper right here, we report the period of polyclonal antibodies (or immunoglobulins, IgGs) raised within the course of goat αs1-casein N- (Nter) and C-terminal (Cter) peptide sequences.The chemical, technological and allergy properties of goat’s milk are significantly affected by the extent of αs1-casein. Detection and quantification of αs1-casein requires high-specificity methods to beat high-sequence similarity between this protein and others throughout the casein family.
The Nter and Cter peptides of goat αs1-casein had been immunized in rabbits for the period of antisera, which had been purified using protein G affinity chromatography. The binding affinity of the antisera and purified IgGs had been examined and in distinction using indirect ELISA, the place peptide-BSA conjugates and goat αs1-casein had been used as a result of the coating antigens.
ZNF287 Antibody, FITC conjugated
|
The Nter antiserum displayed bigger titer than Cter antiserum, at 1/64,000 and 1/32,000 dilutions, respectively. The purification step further yielded 0.5 mg/mL of purified IgGs from Three mL of antisera.
The purified Nter IgG confirmed a significantly (p < 0.05) bigger binding affinity within the course of peptide-BSA and goat αs1-casein, with lower Okayd price at 5.063 × 10-3 μM as compared with 9.046 × 10-3 μM for the Cter IgG.
A cross-reactivity check out confirmed that there was no binding in neither Nter nor Cter IgGs within the course of protein extracts from the milk of cow, buffalo, horse and camel. Extreme-quality antibodies generated will allow further development of immuno-based analytical methods and future in vitro analysis to be carried out on goat αs1-casein.
ZNF287 Antibody |
34071-50ul |
SAB |
50ul |
EUR 187.00 |
ZNF287 Antibody |
39891-100ul |
SAB |
100ul |
EUR 390.00 |
ZNF287 Antibody |
DF3440 |
Affbiotech |
200ul |
EUR 304.00 |
Description: ZNF287 Antibody detects endogenous levels of total ZNF287. |
ZNF287 Antibody |
CSB-PA555215- |
Cusabio |
|
EUR 335.00 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against ZNF287. Recognizes ZNF287 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100 |
ZNF287 Antibody |
CSB-PA555215-100ul |
Cusabio |
100ul |
EUR 316.00 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against ZNF287. Recognizes ZNF287 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100 |
ZNF287 Antibody |
1-CSB-PA026644LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ZNF287. Recognizes ZNF287 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
ZNF287 Antibody |
1-CSB-PA040061 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against ZNF287. Recognizes ZNF287 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000 |
ZNF287 Antibody |
AF0684 |
Affbiotech |
200ul |
EUR 304.00 |
Description: ZNF287 Antibody detects endogenous levels of ZNF287. |
ZNF287 Conjugated Antibody |
C34071 |
SAB |
100ul |
EUR 397.00 |
ZNF287 Polyclonal Antibody |
A63848 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
ZNF287 Polyclonal Antibody |
ABP55891-003ml |
Abbkine |
0.03ml |
EUR 158.00 |
- Immunogen information: Synthesized peptide derived from the Internal region of human ZNF287 at AA range: 210-290
- Applications tips:
|
Description: A polyclonal antibody for detection of ZNF287 from Human. This ZNF287 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ZNF287 at AA range: 210-290 |
ZNF287 Polyclonal Antibody |
ABP55891-01ml |
Abbkine |
0.1ml |
EUR 289.00 |
- Immunogen information: Synthesized peptide derived from the Internal region of human ZNF287 at AA range: 210-290
- Applications tips:
|
Description: A polyclonal antibody for detection of ZNF287 from Human. This ZNF287 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ZNF287 at AA range: 210-290 |
ZNF287 Polyclonal Antibody |
ABP55891-02ml |
Abbkine |
0.2ml |
EUR 414.00 |
- Immunogen information: Synthesized peptide derived from the Internal region of human ZNF287 at AA range: 210-290
- Applications tips:
|
Description: A polyclonal antibody for detection of ZNF287 from Human. This ZNF287 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ZNF287 at AA range: 210-290 |
anti- ZNF287 antibody |
FNab09681 |
FN Test |
100µg |
EUR 585.00 |
- Recommended dilution: WB: 1:200-1:1000
- Immunogen: zinc finger protein 287
- Uniprot ID: Q9HBT7
- Gene ID: 57336
- Research Area: Metabolism
|
Description: Antibody raised against ZNF287 |
ZNF287 Polyclonal Antibody |
ES6890-100ul |
ELK Biotech |
100ul |
EUR 279.00 |
Description: A Rabbit Polyclonal antibody against ZNF287 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
ZNF287 Polyclonal Antibody |
ES6890-50ul |
ELK Biotech |
50ul |
EUR 207.00 |
Description: A Rabbit Polyclonal antibody against ZNF287 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Anti-ZNF287 antibody |
STJ96325 |
St John's Laboratory |
200 µl |
EUR 197.00 |
Description: Rabbit polyclonal to ZNF287. |
ZNF287 siRNA |
20-abx940672 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ZNF287 siRNA |
20-abx940673 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ZNF287 Antibody, HRP conjugated |
1-CSB-PA026644LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ZNF287. Recognizes ZNF287 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
ZNF287 Antibody, FITC conjugated |
1-CSB-PA026644LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ZNF287. Recognizes ZNF287 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
ZNF287 Antibody, Biotin conjugated |
1-CSB-PA026644LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ZNF287. Recognizes ZNF287 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-ZNF287/Zfp287 Antibody |
A17720 |
BosterBio |
100ul |
EUR 397.00 |
Description: Rabbit Polyclonal ZNF287/Zfp287 Antibody. Validated in IHC, WB and tested in Human, Mouse. |
Human ZNF287 shRNA Plasmid |
20-abx961417 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ZNF287 Recombinant Protein (Human) |
RP045112 |
ABM |
100 ug |
Ask for price |
ZNF287 Blocking Peptide |
DF3440-BP |
Affbiotech |
1mg |
EUR 195.00 |
ZNF287 Blocking Peptide |
AF0684-BP |
Affbiotech |
1mg |
EUR 195.00 |
ZNF287 cloning plasmid |
CSB-CL026644HU-10ug |
Cusabio |
10ug |
EUR 474.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2265
- Sequence: ATGAACAGTTCTTCACGTTCTCAAATCCTTCTAAGGTGGAAGTCAGACAAGGCTCAGAGTGGACCCTACAATGTTGAGAAGGAAATCCTTACTTCAAGATTCTTGCGTGACACTGAGACCTGTCGACAGAATTTTAGGAATTTTCCATACCCAGACCTGGCTGGTCCTCGAAAGG
- Show more
|
Description: A cloning plasmid for the ZNF287 gene. |
ZNF287 Polyclonal Antibody, HRP Conjugated |
A63849 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
ZNF287 Polyclonal Antibody, FITC Conjugated |
A63850 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
ZNF287 Polyclonal Antibody, Biotin Conjugated |
A63851 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
ZNF287 ORF Vector (Human) (pORF) |
ORF015038 |
ABM |
1.0 ug DNA |
EUR 354.00 |
Mouse ZNF287 shRNA Plasmid |
20-abx980321 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Zinc Finger Protein 287 (ZNF287) Antibody |
abx037179-100ug |
Abbexa |
100 ug |
EUR 391.00 |
- Shipped within 5-10 working days.
|
Zinc Finger Protein 287 (ZNF287) Antibody |
20-abx013803 |
Abbexa |
- EUR 314.00
- EUR 98.00
- EUR 398.00
- EUR 495.00
|
|
- Shipped within 5-10 working days.
|
Zinc Finger Protein 287 (ZNF287) Antibody |
abx030175-400ul |
Abbexa |
400 ul |
EUR 523.00 |
- Shipped within 5-10 working days.
|
Zinc Finger Protein 287 (ZNF287) Antibody |
abx030175-80l |
Abbexa |
80 µl |
EUR 286.00 |
- Shipped within 5-10 working days.
|
Zinc Finger Protein 287 (ZNF287) Antibody |
abx239681-100ug |
Abbexa |
100 ug |
EUR 551.00 |
- Shipped within 5-12 working days.
|
Zinc Finger Protein 287 (ZNF287) Antibody |
abx330676-100ul |
Abbexa |
100 ul |
EUR 425.00 |
- Shipped within 5-10 working days.
|
Zinc Finger Protein 287 (ZNF287) Antibody |
20-abx324762 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Zinc Finger Protein 287 (ZNF287) Antibody |
20-abx306051 |
Abbexa |
- EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
|
|
- Shipped within 5-10 working days.
|
ZNF287 sgRNA CRISPR Lentivector set (Human) |
K2697601 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
Zinc Finger Protein 287 (ZNF287) Antibody (HRP) |
20-abx306052 |
Abbexa |
- EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Zinc Finger Protein 287 (ZNF287) Antibody (FITC) |
20-abx306053 |
Abbexa |
- EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Zinc Finger Protein 287 (ZNF287) Antibody (Biotin) |
20-abx306054 |
Abbexa |
- EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
|
|
- Shipped within 5-10 working days.
|
ZNF287 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2697602 |
ABM |
1.0 ug DNA |
EUR 154.00 |
ZNF287 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2697603 |
ABM |
1.0 ug DNA |
EUR 154.00 |
ZNF287 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2697604 |
ABM |
1.0 ug DNA |
EUR 154.00 |
ZNF287 Protein Vector (Human) (pPB-C-His) |
PV060149 |
ABM |
500 ng |
EUR 481.00 |
ZNF287 Protein Vector (Human) (pPB-N-His) |
PV060150 |
ABM |
500 ng |
EUR 481.00 |
ZNF287 Protein Vector (Human) (pPM-C-HA) |
PV060151 |
ABM |
500 ng |
EUR 481.00 |