
Human C Reactive Protein Of ELISA Kit


Growth of Pretreatment Protocols for Dedication of Soybean β-Conglycinin in Processed Soybean Meals Utilizing Industrial ELISA Kits


β-Conglycinin is the foremost storage protein in soybeans. Pre-clinical animal fashions and human medical research have demonstrated the triglyceride-lowering impact of this protein, suggesting that it may very well be put into sensible use as a useful meals materials.

Up to now, nevertheless, there aren’t any correct and easy assays for quantification of β-conglycinin. On this research, samples had been pretreated by mixing them with rice flour powder previous to extraction of proteins.

Then, we used commercially accessible ELISA kits for detection of allergens that may very well be current in any contaminating soybean residue. This enabled correct and extremely reproducible quantitation of β-conglycinin content material in a number of processed soybean meals.

Key phrases: ELISA; Kori-tofu; assay; soybean; soymilk; β-conglycinin.


Preparation of ELISA and Lateral Move Kits for fast Prognosis of Mycoplasma gallisepticum in Poultry


  • Avian mycoplasmas had been primarily the reason for poultry business financial losses; decreased meat and egg manufacturing and will increase the antibiotic therapy price.
  • Mycoplasma gallisepticum (MG) an infection is designated as infectious sinusitis of turkeys and persistent respiratory illness of chickens (gasping, melancholy, semi closed eyes, infraorbital sinuses edema and reduce in egg manufacturing).
  • This research aimed to arrange, consider and Examine in-house ELISA kits and lateral circulate assay (LFA) from a neighborhood pressure of MG with business ELISA kits and PCR consequently. A complete of 54 samples (27 tracheal swabs, 10 trachea and 17 lung) and 50 serum samples collected from birds affected by persistent respiratory illness had been examined by ready in-house ELISA, business ELISA kits, PCR and LFA; a excessive correlation coefficient between in-house ELISA utilizing complete antigen or sonicated antigen and business equipment was recorded.



  • Lateral Move assay (LFA) efficiency point out a low sensitivity (77.5%) however preserve a excessive specificity (92%) in comparison with PCR. The in-house ELISA kits and LFA ready may very well be used as a quick diagnostic method for detection of MG in Egypt.
  • Based on the accessible information the ready LFA for analysis of MG an infection in chickens was developed for the primary time in Egypt.


Human C Reactive Protein (CRP) ELISA Package


  • Ought to the Human C Reactive Protein (CRP) ELISA Package is confirmed to point out malperformance, you’ll obtain a refund or a free alternative.
Description: A sandwich quantitative ELISA assay equipment for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell tradition supernates or different organic fluids.

Chicken C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Ch-48T 48T
EUR 508.00
  • Should the Chicken C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Chicken C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Ch-96T 96T
EUR 661.00
  • Should the Chicken C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Hu-48T 48T
EUR 385.00
  • Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Hu-96T 96T
EUR 492.00
  • Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids.

Mouse C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Mu-48T 48T
EUR 489.00
  • Should the Mouse C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Mu-96T 96T
EUR 635.00
  • Should the Mouse C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine C Reactive Protein (CRP) ELISA Kit

DLR-CRP-p-48T 48T
EUR 547.00
  • Should the Porcine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine C Reactive Protein (CRP) ELISA Kit

DLR-CRP-p-96T 96T
EUR 715.00
  • Should the Porcine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Ra-48T 48T
EUR 426.00
  • Should the Rat C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Ra-96T 96T
EUR 549.00
  • Should the Rat C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rabbit C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Rb-48T 48T
EUR 508.00
  • Should the Rabbit C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Rabbit C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Rb-96T 96T
EUR 661.00
  • Should the Rabbit C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Bovine C Reactive Protein (CRP) ELISA Kit

RDR-CRP-b-48Tests 48 Tests
EUR 580.00

Bovine C Reactive Protein (CRP) ELISA Kit

RDR-CRP-b-96Tests 96 Tests
EUR 807.00

Chicken C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Ch-48Tests 48 Tests
EUR 534.00

Chicken C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Ch-96Tests 96 Tests
EUR 742.00

Human C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Hu-48Tests 48 Tests
EUR 388.00

Human C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Hu-96Tests 96 Tests
EUR 533.00

Mouse C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Mu-48Tests 48 Tests
EUR 511.00

Mouse C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Mu-96Tests 96 Tests
EUR 709.00

Porcine C Reactive Protein (CRP) ELISA Kit

RDR-CRP-p-48Tests 48 Tests
EUR 580.00

Porcine C Reactive Protein (CRP) ELISA Kit

RDR-CRP-p-96Tests 96 Tests
EUR 807.00

Rat C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Ra-48Tests 48 Tests
EUR 437.00

Rat C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Ra-96Tests 96 Tests
EUR 603.00

Rabbit C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Rb-48Tests 48 Tests
EUR 534.00

Rabbit C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Rb-96Tests 96 Tests
EUR 742.00

Bovine C Reactive Protein (CRP) ELISA Kit

RD-CRP-b-48Tests 48 Tests
EUR 555.00

Bovine C Reactive Protein (CRP) ELISA Kit

RD-CRP-b-96Tests 96 Tests
EUR 771.00

Chicken C Reactive Protein (CRP) ELISA Kit

RD-CRP-Ch-48Tests 48 Tests
EUR 511.00

Chicken C Reactive Protein (CRP) ELISA Kit

RD-CRP-Ch-96Tests 96 Tests
EUR 709.00

Human C Reactive Protein (CRP) ELISA Kit

RD-CRP-Hu-48Tests 48 Tests
EUR 372.00

Human C Reactive Protein (CRP) ELISA Kit

RD-CRP-Hu-96Tests 96 Tests
EUR 510.00

Mouse C Reactive Protein (CRP) ELISA Kit

RD-CRP-Mu-48Tests 48 Tests
EUR 489.00

Mouse C Reactive Protein (CRP) ELISA Kit

RD-CRP-Mu-96Tests 96 Tests
EUR 677.00

Porcine C Reactive Protein (CRP) ELISA Kit

RD-CRP-p-48Tests 48 Tests
EUR 555.00

Porcine C Reactive Protein (CRP) ELISA Kit

RD-CRP-p-96Tests 96 Tests
EUR 771.00

Rat C Reactive Protein (CRP) ELISA Kit

RD-CRP-Ra-48Tests 48 Tests
EUR 419.00

Rat C Reactive Protein (CRP) ELISA Kit

RD-CRP-Ra-96Tests 96 Tests
EUR 577.00

Rabbit C Reactive Protein (CRP) ELISA Kit

RD-CRP-Rb-48Tests 48 Tests
EUR 511.00

Rabbit C Reactive Protein (CRP) ELISA Kit

RD-CRP-Rb-96Tests 96 Tests
EUR 709.00

Anti-CRP/C Reactive Protein Antibody

A00249 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for CRP Antibody (CRP) detection.tested for IHC, WB in Human, Rat.

Anti-C Reactive Protein/Crp Antibody

A00249-1 100ug/vial
EUR 334.00

Anti-C Reactive Protein/Crp Antibody

A00249-2 100ug/vial
EUR 334.00

Anti-C Reactive Protein/CRP Antibody

A00249-4 100ug/vial
EUR 334.00

Anti-C Reactive Protein/CRP Antibody

PA1028 100ug/vial
EUR 294.00

Anti-C-reactive Protein (CRP) antibody

STJ130001 50 µl
EUR 321.00
Description: C-Reactive Protein (CRP) is an annular, pentameric protein found in blood plasma. CRP belongs to the beta-globulin family of plasma proteins and its name is derived from the ability to precipitate a group C polysaccharide of pneumococcus in the presence of Ca2+. Serum levels of CRP are elevated in a wide variety of acute and chronic inflammatory conditions. These conditions include most bacterial and some viral infections, rheumatic fever, rheumatoid arthritis, and many collagen diseases. CRP serum levels are also valuable in detection and evaluation of tissue injury, acute myocardial infarction, transplant rejection, and several malignant disorders.

Anti-C-reactive Protein (CRP) antibody

STJ130002 50 µl
EUR 321.00
Description: C-Reactive Protein (CRP) is an annular, pentameric protein found in blood plasma. CRP belongs to the beta-globulin family of plasma proteins and its name is derived from the ability to precipitate a group C polysaccharide of pneumococcus in the presence of Ca2+. Serum levels of CRP are elevated in a wide variety of acute and chronic inflammatory conditions. These conditions include most bacterial and some viral infections, rheumatic fever, rheumatoid arthritis, and many collagen diseases. CRP serum levels are also valuable in detection and evaluation of tissue injury, acute myocardial infarction, transplant rejection, and several malignant disorders.

Anti-C-reactive Protein (CRP) antibody

STJ130003 50 µl
EUR 321.00
Description: C-Reactive Protein (CRP) is an annular, pentameric protein found in blood plasma. CRP belongs to the beta-globulin family of plasma proteins and its name is derived from the ability to precipitate a group C polysaccharide of pneumococcus in the presence of Ca2+. Serum levels of CRP are elevated in a wide variety of acute and chronic inflammatory conditions. These conditions include most bacterial and some viral infections, rheumatic fever, rheumatoid arthritis, and many collagen diseases. CRP serum levels are also valuable in detection and evaluation of tissue injury, acute myocardial infarction, transplant rejection, and several malignant disorders.

Guinea pig C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Gu-48T 48T
EUR 527.00
  • Should the Guinea pig C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Guinea pig C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Gu-96T 96T
EUR 688.00
  • Should the Guinea pig C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Guinea pig C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Gu-48Tests 48 Tests
EUR 557.00


Human Protein Kinase N1 (PKN1) ELISA Package



  • Ought to the Human Protein Kinase N1 (PKN1) ELISA Package is confirmed to point out malperformance, you’ll obtain a refund or a free alternative.
Description: A sandwich quantitative ELISA assay equipment for detection of Human Protein Kinase N1 (PKN1) in samples from tissue homogenates, cell lysates or different organic fluids.

Fish is a significant meals and allergen supply, requiring declaration on packaged meals, usually ensured by using ELISAs. Over 1,000 totally different fish species are traded and consumed worldwide, more and more supplied by aquaculture. As much as 3% of the overall inhabitants are prone to typically deadly allergic reactions to fish, requiring strict avoidance of this meals commodity.

The goal of this research is to guage the capability of three commercially accessible ELISA exams to detect all kinds of bony and cartilaginous fish and their merchandise, important to make sure dependable and secure meals labeling.

The detection of 57 bony fish ranged from 26% to 61%. Widespread European and North American species together with carp, cod, and salmon species demonstrated the next detection price as in comparison with these from the Asia-Pacific, together with pangasius and a number of other mackerel and tuna species. Among the many 17 canned bony fish merchandise, solely 65% to 86% had been detected, with tuna exhibiting the bottom price.

Not one of the cartilaginous fish (n=9) in addition to different vertebrates (n=8) or shellfish (n=5) had been detected.We reveal a restricted capability of three business fish ELISA kits to detect fish and their merchandise.

The complexity of fish as an rising utilized protein supply raises the pressing want for improved detection strategies, essential for the meals business to supply secure seafood merchandise and adjust to worldwide legislations. This text is protected by copyright. All rights reserved.


PKN1 Antibody



  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography utilizing epitope-specific immunogen.
Description: A polyclonal antibody towards PKN1. Acknowledges PKN1 from Human, Mouse, Rat. This antibody is Unconjugated.

Examined within the following software: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000






YF-PA13998 100 ug
EUR 403.00
Description: Rabbit polyclonal to PKN1


YF-PA27338 100 ul
EUR 403.00
Description: Rabbit polyclonal to PKN1

Human Protein Kinase N1 (PKN1) ELISA Kit

DLR-PKN1-Hu-48T 48T
EUR 479.00
  • Should the Human Protein Kinase N1 (PKN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Kinase N1 (PKN1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Protein Kinase N1 (PKN1) ELISA Kit

DLR-PKN1-Hu-96T 96T
EUR 621.00
  • Should the Human Protein Kinase N1 (PKN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Kinase N1 (PKN1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Protein Kinase N1 (PKN1) ELISA Kit

RDR-PKN1-Hu-48Tests 48 Tests
EUR 500.00

Human Protein Kinase N1 (PKN1) ELISA Kit

RDR-PKN1-Hu-96Tests 96 Tests
EUR 692.00

Human Protein Kinase N1 (PKN1) ELISA Kit

RD-PKN1-Hu-48Tests 48 Tests
EUR 478.00

Human Protein Kinase N1 (PKN1) ELISA Kit

RD-PKN1-Hu-96Tests 96 Tests
EUR 662.00

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349.00

Anti-PKN1 (1B10)

YF-MA14890 100 ug
EUR 363.00
Description: Mouse monoclonal to PKN1

Anti-PKN1 (1A4)

YF-MA14891 100 ug
EUR 363.00
Description: Mouse monoclonal to PKN1

PKN1 Antibody

48392-100ul 100ul
EUR 333.00

PKN1 Antibody

48392-50ul 50ul
EUR 239.00

PKN1 Antibody

DF4790 200ul
EUR 304.00
Description: PKN1 Antibody detects endogenous levels of total PKN1.

PKN1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PKN1. Recognizes PKN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

PKN1 antibody

70R-50256 100 ul
EUR 244.00
Description: Purified Polyclonal PKN1 antibody

PKN1 Antibody

ABD4790 100 ug
EUR 438.00

PKN1/PRK1 Antibody

35295-100ul 100ul
EUR 252.00

PKN1/PRK1 Antibody

35295-50ul 50ul
EUR 187.00

PKN1 Conjugated Antibody

C48392 100ul
EUR 397.00

PKN1 Polyclonal Antibody

ABP59926-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
  • Applications tips:
Description: A polyclonal antibody for detection of PKN1 from Human, Mouse, Rat. This PKN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800

PKN1 Polyclonal Antibody

ABP59926-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
  • Applications tips:
Description: A polyclonal antibody for detection of PKN1 from Human, Mouse, Rat. This PKN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800

PKN1 Polyclonal Antibody

ABP59926-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
  • Applications tips:
Description: A polyclonal antibody for detection of PKN1 from Human, Mouse, Rat. This PKN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800

PKN1 Polyclonal Antibody

ES8989-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against PKN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PKN1 Polyclonal Antibody

ES8989-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against PKN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Pkn1/ Rat Pkn1 ELISA Kit

ELI-37289r 96 Tests
EUR 886.00


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PKN1/PRK1 Conjugated Antibody

C35295 100ul
EUR 397.00

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280.00

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280.00

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280.00

PKN1 Rabbit pAb

A0553-100ul 100 ul
EUR 308.00

PKN1 Rabbit pAb

A0553-200ul 200 ul
EUR 459.00

PKN1 Rabbit pAb

A0553-20ul 20 ul
EUR 183.00

PKN1 Rabbit pAb

A0553-50ul 50 ul
EUR 223.00

PKN1 Blocking Peptide

DF4790-BP 1mg
EUR 195.00

PKN1 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PKN1 cloning plasmid

CSB-CL623082HU-10ug 10ug
EUR 902.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2829
  • Sequence: atggccagcgacgccgtgcagagtgagcctcgcagctggtccctgctagagcagctgggcctggccggggcagacctggcggcccccggggtacagcagcagctggagctggagcgggagcggctgcggcgggaaatccgcaaggagctgaagctgaaggagggtgctgagaacc
  • Show more
Description: A cloning plasmid for the PKN1 gene.

Protein Kinase N1 (PKN1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.