stat-2

Cell Repertoires Poorly-Neutralizing antibodies

Human C. difficile toxin-specific reminiscence B cell repertoires encode poorly-neutralizing antibodies

Clostridioides difficile is a number one reason behind nosocomial an infection accountable for important morbidity and mortality with restricted choices for remedy. Secreted C. difficile toxin B (TcdB) is a significant contributor to illness pathology and choose TcdB-specific Abs could defend in opposition to illness recurrence.

Nevertheless, the excessive frequency of recurrence means that the reminiscence B cell response, important for brand new Ab manufacturing following C. difficile re-exposure, is inadequate. We due to this fact remoted TcdB-specific reminiscence B cells from people with a historical past of C. difficile an infection and carried out single-cell deep sequencing of their Ab genes.

Herein, we report that TcdB-specific reminiscence B cell-encoded antibodies confirmed somatic hypermutation however displayed restricted isotype class change.

Reminiscence B cell-encoded monoclonal antibodies generated from the gene sequences revealed low to reasonable affinity for TcdB and a restricted capacity to neutralize TcdB. These findings point out that reminiscence B cells are an necessary think about C. difficile illness recurrence.

 

stat-2

stat-2

 

NUSAP1 Antibody

  • Buffer: Rabbit IgG in phosphate buffered saline (with out Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography utilizing epitope-specific
Description:     A polyclonal antibody in opposition to NUSAP1. Acknowledges NUSAP1 from Human. This antibody is Unconjugated. Examined within the following utility: ELISA, WB;WB:1:500-1:3000

 

 

anti-NUSAP1
YF-PA18921 50 ug
EUR 363.00
Description: Mouse polyclonal to NUSAP1
Anti-NUSAP1/Ankt Antibody
A06066 100ul
EUR 397.00
Description: Rabbit Polyclonal NUSAP1/Ankt Antibody. Validated in WB and tested in Human.
Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349.00
NUSAP1 antibody
70R-19012 50 ul
EUR 435.00
Description: Rabbit polyclonal NUSAP1 antibody
NUSAP1 antibody
70R-2155 50 ug
EUR 467.00
Description: Rabbit polyclonal NUSAP1 antibody raised against the middle region of NUSAP1
NUSAP1 antibody
70R-2411 50 ug
EUR 467.00
Description: Rabbit polyclonal NUSAP1 antibody raised against the C terminal of NUSAP1
NUSAP1 Antibody
34873-100ul 100ul
EUR 252.00
NUSAP1 Antibody
34873-50ul 50ul
EUR 187.00
NUSAP1 Antibody
1-CSB-PA827577
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NUSAP1. Recognizes NUSAP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000
NUSAP1 Antibody
1-CSB-PA000877
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NUSAP1. Recognizes NUSAP1 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
NUSAP1 Antibody
1-CSB-PA090980
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NUSAP1. Recognizes NUSAP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000
NUSAP1 Antibody
DF4261 200ul
EUR 304.00
Description: NUSAP1 Antibody detects endogenous levels of total NUSAP1.
NUSAP1 Antibody
1-CSB-PA016213GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NUSAP1. Recognizes NUSAP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
NUSAP1 Antibody
CSB-PA222749-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against NUSAP1. Recognizes NUSAP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
NUSAP1 Antibody
CSB-PA222749-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against NUSAP1. Recognizes NUSAP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
NUSAP1 Antibody
ABD4261 100 ug
EUR 438.00
NUSAP1 Conjugated Antibody
C34873 100ul
EUR 397.00
NUSAP1 siRNA
20-abx926663
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
NUSAP1 siRNA
20-abx926664
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
pENTR223- NUSAP1
PVT10053 2 ug
EUR 266.00
NUSAP1 Rabbit pAb
A16000-100ul 100 ul
EUR 308.00
NUSAP1 Rabbit pAb
A16000-200ul 200 ul
EUR 459.00
NUSAP1 Rabbit pAb
A16000-20ul 20 ul
EUR 183.00
NUSAP1 Rabbit pAb
A16000-50ul 50 ul
EUR 223.00
NUSAP1 Blocking Peptide
33R-5074 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NUSAP1 antibody, catalog no. 70R-2411
NUSAP1 Blocking Peptide
33R-1139 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of IVL antibody, catalog no. 70R-2846
NUSAP1 Blocking Peptide
DF4261-BP 1mg
EUR 195.00
NUSAP1 cloning plasmid
CSB-CL887151HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 678
  • Sequence: atgaatgaactgaagcagcccatcaataagggaggggtcaggactccagtacctccaagaggaagactctctgtggcttctactcccatcagccaacgacgctcgcaaggccggtcttgtggccctgcaagtcagagtaccttgggtctgaaggggtcactcaagcgctctgctat
  • Show more
Description: A cloning plasmid for the NUSAP1 gene.
NUSAP1 cloning plasmid
CSB-CL887151HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1323
  • Sequence: atgatcatcccctctctagaggagctggactccctcaagtacagtgacctgcagaacttagccaagagtctgggtctccgggccaacctgagggcaaccaagttgttaaaagccttgaaaggctacattaaacatgaggcaagaaaaggaaatgagaatcaggatgaaagtcaaa
  • Show more
Description: A cloning plasmid for the NUSAP1 gene.
NUSAP1 cloning plasmid
CSB-CL887151HU3-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1323
  • Sequence: atgatcatcccctctctagaggagctggactccctcaagtacagtgacctgcagaacttagccaagagtctgggtctccgggccaacctgagggcaaccaagttgttaaaagccttgaaaggctacattaaacatgaggcaagaaaaggaaatgagaatcaggatgaaagtcaaa
  • Show more
Description: A cloning plasmid for the NUSAP1 gene.
NUSAP1 cloning plasmid
CSB-CL887151HU4-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1320
  • Sequence: atgatcatcccctctctagaggagctggactccctcaagtacagtgacctgcagaacttagccaagagtctgggtctccgggccaacctgagggcaaccaagttgttaaaagccttgaaaggctacattaaacatgaggcaagaaaaggaaatgagaatcaggatgaaagtcaaa
  • Show more
Description: A cloning plasmid for the NUSAP1 gene.
Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280.00
Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280.00
Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280.00
Human NUSAP1 ELISA Kit
ELA-E0523h 96 Tests
EUR 824.00
NUSAP1 ELISA KIT|Human
EF000647 96 Tests
EUR 689.00
Human NUSAP1 shRNA Plasmid
20-abx959604
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse NUSAP1 shRNA Plasmid
20-abx979943
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
NUSAP1 Recombinant Protein (Human)
RP021958 100 ug Ask for price
NUSAP1 Recombinant Protein (Human)
RP021961 100 ug Ask for price
NUSAP1 Recombinant Protein (Human)
RP021964 100 ug Ask for price
NUSAP1 Recombinant Protein (Human)
RP021967 100 ug Ask for price
NUSAP1 Recombinant Protein (Mouse)
RP155543 100 ug Ask for price
NUSAP1 Recombinant Protein (Mouse)
RP155546 100 ug Ask for price
NUSAP1 Recombinant Protein (Rat)
RP214895 100 ug Ask for price
Nusap1 ORF Vector (Rat) (pORF)
ORF071633 1.0 ug DNA
EUR 506.00
NUSAP1 ORF Vector (Human) (pORF)
ORF007320 1.0 ug DNA
EUR 95.00
NUSAP1 ORF Vector (Human) (pORF)
ORF007321 1.0 ug DNA
EUR 95.00
NUSAP1 ORF Vector (Human) (pORF)
ORF007322 1.0 ug DNA
EUR 95.00
NUSAP1 ORF Vector (Human) (pORF)
ORF007323 1.0 ug DNA
EUR 95.00
Nusap1 ORF Vector (Mouse) (pORF)
ORF051849 1.0 ug DNA
EUR 506.00

NUSAP1 Recombinant Protein (Human)

Most cancers cachexia is a extremely prevalent situation related to poor high quality of life and lowered survival1. Tumor-induced perturbations within the endocrine, immune and nervous techniques drive anorexia and catabolic modifications in adipose tissue and skeletal muscle, hallmarks of most cancers cachexia2-4.

Nevertheless, the molecular mechanisms driving cachexia stay poorly outlined, and there are at the moment no accepted medicine for the situation.

Elevation in circulating progress differentiation issue 15 (GDF15) correlates with cachexia and lowered survival in sufferers with most cancers5-8, and a GDNF household receptor alpha like (GFRAL)-Ret proto-oncogene (RET) signaling advanced in brainstem neurons that mediates GDF15-induced weight reduction in mice has not too long ago been described9-12.

Right here we report a therapeutic antagonistic monoclonal antibody, 3P10, that targets GFRAL and inhibits RET signaling by stopping the GDF15-driven interplay of RET with GFRAL on the cell floor.

Remedy with 3P10 reverses extreme lipid oxidation in tumor-bearing mice and prevents most cancers cachexia, even underneath calorie-restricted situations. Mechanistically, activation of the GFRAL-RET pathway induces expression of genes concerned in lipid metabolism in adipose tissues, and each peripheral chemical sympathectomy and lack of adipose triglyceride lipase defend mice from GDF15-induced weight reduction.

These information uncover a peripheral sympathetic axis by which GDF15 elicits a lipolytic response in adipose tissue independently of anorexia, resulting in lowered adipose and muscle mass and performance in tumor-bearing mice.

 

 

NUSAP1 cloning plasmid

Regardless of the introduction of novel brokers comparable to proteasome inhibitors, immunomodulatory medicine, and autologous stem cell transplant, a number of myeloma (MM) largely stays an incurable illness.

In recent times, monoclonal antibody-based remedy methods have been developed to focus on particular floor antigens on MM cells.

Remedy with bispecific antibodies (bsAbs) is an immunotherapeutic technique that results in an enhanced interplay between MM cells and immune effector cells, e.g., T-cells and pure killer cells.

With the immune synapse constructed by bsAbs, the elimination of MM cells will be facilitated. Thus far, bsAbs have demonstrated encouraging ends in preclinical research, and scientific trials evaluating bsAbs in sufferers with MM are ongoing. Early scientific information present the promising efficacy of bsAbs in relapsed/refractory MM.

Along with chimeric antigen receptor-modified (CAR)-T-cells, bsAbs symbolize a brand new dimension of precision drugs. On this evaluation, we offer an summary of rationale, present scientific growth, resistance mechanisms, and future instructions of bsAbs in MM.

 

Human Matrix Metalloproteinase 8 (MMP8) ELISA Kit

DLR-MMP8-Hu-96T 96T
EUR 477.00
  • Should the Human Matrix Metalloproteinase 8 (MMP8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Matrix Metalloproteinase 8 (MMP8) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Matrix Metalloproteinase 8 (MMP8) ELISA Kit

DLR-MMP8-Mu-48T 48T
EUR 489.00
  • Should the Mouse Matrix Metalloproteinase 8 (MMP8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Matrix Metalloproteinase 8 (MMP8) in samples from serum, plasma or other biological fluids.

Mouse Matrix Metalloproteinase 8 (MMP8) ELISA Kit

DLR-MMP8-Mu-96T 96T
EUR 635.00
  • Should the Mouse Matrix Metalloproteinase 8 (MMP8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Matrix Metalloproteinase 8 (MMP8) in samples from serum, plasma or other biological fluids.

Rat Matrix Metalloproteinase 8 (MMP8) ELISA Kit

DLR-MMP8-Ra-48T 48T
EUR 508.00
  • Should the Rat Matrix Metalloproteinase 8 (MMP8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Matrix Metalloproteinase 8 (MMP8) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Matrix Metalloproteinase 8 (MMP8) ELISA Kit

DLR-MMP8-Ra-96T 96T
EUR 661.00
  • Should the Rat Matrix Metalloproteinase 8 (MMP8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Matrix Metalloproteinase 8 (MMP8) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Matrix Metalloproteinase 8 (MMP8) ELISA Kit

RD-MMP8-Hu-48Tests 48 Tests
EUR 360.00

Human Matrix Metalloproteinase 8 (MMP8) ELISA Kit

RD-MMP8-Hu-96Tests 96 Tests
EUR 493.00

Mouse Matrix Metalloproteinase 8 (MMP8) ELISA Kit

RD-MMP8-Mu-48Tests 48 Tests
EUR 489.00

Mouse Matrix Metalloproteinase 8 (MMP8) ELISA Kit

RD-MMP8-Mu-96Tests 96 Tests
EUR 677.00

Rat Matrix Metalloproteinase 8 (MMP8) ELISA Kit

RD-MMP8-Ra-48Tests 48 Tests
EUR 511.00

Rat Matrix Metalloproteinase 8 (MMP8) ELISA Kit

RD-MMP8-Ra-96Tests 96 Tests
EUR 709.00

Human Matrix Metalloproteinase 8 (MMP8) ELISA Kit

RDR-MMP8-Hu-48Tests 48 Tests
EUR 376.00

Human Matrix Metalloproteinase 8 (MMP8) ELISA Kit

RDR-MMP8-Hu-96Tests 96 Tests
EUR 515.00

Mouse Matrix Metalloproteinase 8 (MMP8) ELISA Kit

RDR-MMP8-Mu-48Tests 48 Tests
EUR 511.00

Mouse Matrix Metalloproteinase 8 (MMP8) ELISA Kit

RDR-MMP8-Mu-96Tests 96 Tests
EUR 709.00

Rat Matrix Metalloproteinase 8 (MMP8) ELISA Kit

RDR-MMP8-Ra-48Tests 48 Tests
EUR 534.00

Rat Matrix Metalloproteinase 8 (MMP8) ELISA Kit

RDR-MMP8-Ra-96Tests 96 Tests
EUR 742.00

Guinea pig Matrix Metalloproteinase 8 (MMP8) ELISA Kit

DLR-MMP8-Gu-48T 48T
EUR 527.00
  • Should the Guinea pig Matrix Metalloproteinase 8 (MMP8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig Matrix Metalloproteinase 8 (MMP8) in samples from serum, plasma or other biological fluids.

Guinea pig Matrix Metalloproteinase 8 (MMP8) ELISA Kit

DLR-MMP8-Gu-96T 96T
EUR 688.00
  • Should the Guinea pig Matrix Metalloproteinase 8 (MMP8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig Matrix Metalloproteinase 8 (MMP8) in samples from serum, plasma or other biological fluids.

Guinea pig Matrix Metalloproteinase 8 (MMP8) ELISA Kit

RD-MMP8-Gu-48Tests 48 Tests
EUR 533.00

Guinea pig Matrix Metalloproteinase 8 (MMP8) ELISA Kit

RD-MMP8-Gu-96Tests 96 Tests
EUR 740.00

Guinea pig Matrix Metalloproteinase 8 (MMP8) ELISA Kit

RDR-MMP8-Gu-48Tests 48 Tests
EUR 557.00

Guinea pig Matrix Metalloproteinase 8 (MMP8) ELISA Kit

RDR-MMP8-Gu-96Tests 96 Tests
EUR 774.00

Matrix Metalloproteinase 8 (MMP8) Antibody

20-abx113628
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Matrix Metalloproteinase 8 (MMP8) Antibody

20-abx002192
  • EUR 411.00
  • EUR 592.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Matrix Metalloproteinase 8 (MMP8) Antibody

20-abx102673
  • EUR 314.00
  • EUR 133.00
  • EUR 815.00
  • EUR 425.00
  • EUR 272.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Matrix Metalloproteinase 8 (MMP8) Antibody

20-abx102674
  • EUR 300.00
  • EUR 133.00
  • EUR 801.00
  • EUR 425.00
  • EUR 258.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Matrix Metalloproteinase 8 (MMP8) Antibody

20-abx008981
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Matrix Metalloproteinase 8 (MMP8) Antibody

20-abx011174
  • EUR 439.00
  • EUR 91.00
  • EUR 133.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Matrix Metalloproteinase 8 (MMP8) Antibody

20-abx013151
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Matrix Metalloproteinase 8 (MMP8) Antibody

abx027560-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Matrix Metalloproteinase 8 (MMP8) Antibody

abx027560-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Matrix Metalloproteinase 8 (MMP8) Antibody

20-abx173513
  • EUR 300.00
  • EUR 704.00
  • EUR 356.00
  • EUR 154.00
  • EUR 244.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-12 working days.

Matrix Metalloproteinase 8 (MMP8) Antibody

20-abx173514
  • EUR 843.00
  • EUR 439.00
  • 0
  • 1
  • Please enquire.

Matrix Metalloproteinase 8 (MMP8) Antibody

20-abx173515
  • EUR 871.00
  • EUR 453.00
  • 0
  • 1
  • Please enquire.

Matrix Metalloproteinase 8 (MMP8) Antibody

20-abx177508
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-12 working days.

Matrix Metalloproteinase 8 (MMP8) Antibody

20-abx177509
  • EUR 1135.00
  • EUR 551.00
  • 0
  • 1
  • Please enquire.

Matrix Metalloproteinase 8 (MMP8) Antibody

20-abx177510
  • EUR 1233.00
  • EUR 592.00
  • 0
  • 1
  • Please enquire.

Matrix Metalloproteinase 8 (MMP8) Antibody

20-abx328585
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Matrix Metalloproteinase 8 (MMP8) Antibody

20-abx317928
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Matrix Metalloproteinase 8 (MMP8) Antibody

abx235246-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Matrix Metalloproteinase 8 (MMP8) Antibody

20-abx211068
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Matrix Metalloproteinase 8 (MMP8) Antibody

20-abx211173
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Matrix Metalloproteinase 8 (MMP8) siRNA

20-abx903294
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Matrix Metalloproteinase 8 (MMP8) siRNA

20-abx924328
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Matrix Metalloproteinase 8 (MMP8) siRNA

20-abx924329
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Recombinant Matrix Metalloproteinase 8 (MMP8)

4-RPA103Hu01
  • EUR 619.68
  • EUR 269.00
  • EUR 2048.80
  • EUR 749.60
  • EUR 1399.20
  • EUR 478.00
  • EUR 4972.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P22894
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 43.2kDa
  • Isoelectric Point: 5.8
Description: Recombinant Human Matrix Metalloproteinase 8 expressed in: E.coli

Recombinant Matrix Metalloproteinase 8 (MMP8)

4-RPA103Ra01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: O88766
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.2kDa
  • Isoelectric Point: 6.9
Description: Recombinant Rat Matrix Metalloproteinase 8 expressed in: E.coli

Matrix metalloproteinase 8 (MMP8) polyclonal antibody

ABP-PAB-10876 100 ug Ask for price
    • Product line: Proteases
    • Brand:

Matrix Metalloproteinase 8 (MMP8) Antibody (FITC)

20-abx273844
  • EUR 342.00
  • EUR 217.00
  • EUR 940.00
  • EUR 481.00
  • EUR 286.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-15 working days.

Matrix Metalloproteinase 8 (MMP8) Antibody (HRP)

20-abx314968
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Matrix Metalloproteinase 8 (MMP8) Antibody (FITC)

20-abx314969
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Matrix Metalloproteinase 8 (MMP8) Antibody (Biotin)

20-abx314970
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Matrix Metalloproteinase 8 (MMP8) Antibody (Biotin)

20-abx271921
  • EUR 328.00
  • EUR 217.00
  • EUR 885.00
  • EUR 453.00
  • EUR 272.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-15 working days.

Mouse Matrix Metalloproteinase 8 (MMP8) Protein

20-abx654322
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-15 working days.