

All-atom empirical potential for molecular modeling and dynamics research of proteins

New protein parameters are reported for the all-atom empirical vitality operate within the CHARMM program. The parameter analysis was primarily based on a self-consistent method designed to attain a stability between the inner (bonding) and interplay (nonbonding) phrases of the drive discipline and among the many solvent-solvent, solvent-solute, and solute-solute interactions.

Optimization of the inner parameters used experimental gas-phase geometries, vibrational spectra, and torsional vitality surfaces supplemented with ab initio outcomes. The peptide spine bonding parameters had been optimized with respect to information for N-methylacetamide and the alanine dipeptide.

The interplay parameters, significantly the atomic prices, had been decided by becoming ab initio interplay energies and geometries of complexes between water and mannequin compounds that represented the spine and the varied facet chains.

DDAH1 Protein (Recombinant)

As well as, dipole moments, experimental heats and free energies of vaporization, solvation and sublimation, molecular volumes, and crystal pressures and constructions had been used within the optimization. The ensuing protein parameters had been examined by making use of them to noncyclic tripeptide crystals, cyclic peptide crystals, and the proteins crambin, bovine pancreatic trypsin inhibitor, and carbonmonoxy myoglobin in vacuo and in crystals.

An in depth evaluation of the connection between the alanine dipeptide potential vitality floor and calculated protein φ, χ angles was made and utilized in optimizing the peptide group torsional parameters. The outcomes display that use of ab initio structural and energetic information by themselves should not ample to acquire an ample spine illustration for peptides and proteins in answer and in crystals.

Intensive comparisons between molecular dynamics simulations and experimental information for polypeptides and proteins had been carried out for each structural and dynamic properties. Power minimization and dynamics simulations for crystals display that the latter are wanted to acquire significant comparisons with experimental crystal constructions.



The offered parameters, together with the beforehand revealed CHARMM all-atom parameters for nucleic acids and lipids, present a constant set for condensed-phase simulations of all kinds of molecules of organic curiosity.

SWISS-MODEL and the Swiss-PdbViewer: an setting for comparative protein modeling.


Comparative protein modeling is more and more gaining curiosity since it’s of nice help in the course of the rational design of mutagenesis experiments. The supply of this technique, and the ensuing fashions, has nonetheless been restricted by the supply of high-priced pc {hardware} and software program.

To beat these limitations, we’ve got developed an setting for comparative protein modeling that consists of SWISS-MODEL, a server for automated comparative protein modeling and of the SWISS-PdbViewer, a sequence to construction workbench.

TIAL1Human Recombinant Protein

The Swiss-PdbViewer not solely acts as a shopper for SWISS-MODEL, but additionally gives a big collection of construction evaluation and show instruments. As well as, we offer the SWISS-MODEL Repository, a database containing greater than 3500 routinely generated protein fashions. By making such instruments freely obtainable to the scientific group, we hope to extend using protein constructions and fashions within the technique of experiment design.

Recombinant Protein G

7-05936 10mg Ask for price

Recombinant Protein G

7-05937 100mg Ask for price

Recombinant Protein A

DAG390 1g
EUR 1940

PTPN1 Protein (Recombinant)

  • EUR 230.00
  • EUR 2332.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

PPM1A Protein (Recombinant)

  • EUR 230.00
  • EUR 2332.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

PTP4A3 Protein (Recombinant)

  • EUR 230.00
  • EUR 2332.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

SKP1 Protein (Recombinant)

  • EUR 2861.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

Ketohexokinase Protein (Recombinant)

  • EUR 2861.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

NGAL Protein (Recombinant)

  • EUR 328.00
  • EUR 3084.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

DDAH1 Protein (Recombinant)

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

PTP4A1 Protein (Recombinant)

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

PPP3R1 Protein (Recombinant)

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

PPM1F Protein (Recombinant)

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

PPME1 Protein (Recombinant)

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

PPP4C Protein (Recombinant)

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

ACAD8 Protein (Recombinant)

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

ACAT2 Protein (Recombinant)

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RNASE3 Protein (Recombinant)

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

MAPKAPK3 Protein (Recombinant)

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

PRKAB2 Protein (Recombinant)

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

ATF3 Protein (Recombinant)

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

DYRK1A Protein (Recombinant)

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

PTPN6 Protein (Recombinant)

  • EUR 3530.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

NGAL Protein (Recombinant)

  • EUR 3766.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

NGAL Protein (Recombinant)

  • EUR 328.00
  • EUR 4281.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

PTPMT1 Protein (Recombinant)

  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

PPP1R14A Protein (Recombinant)

  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

PPP1R2 Protein (Recombinant)

  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

PRKA1RA Protein (Recombinant)

  • EUR 4615.00
  • EUR 230.00
  • EUR 328.00
  • 100 ug
  • 1 µg
  • 3 µg
  • Shipped within 5-10 working days.

PPARG Protein (Recombinant)

  • EUR 328.00
  • EUR 5924.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

PPP3R2 Protein (Recombinant)

  • EUR 6397.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

ACADL Protein (Recombinant)

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

ACADVL Protein (Recombinant)

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

ACADS Protein (Recombinant)

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

ACADM Protein (Recombinant)

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

ACADSB Protein (Recombinant)

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

PPP1R8 Protein (Recombinant)

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

ATF4 Protein (Recombinant)

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

CDK2 Protein (Recombinant)

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

FGFR1 Protein (Recombinant)

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Ribokinase Protein (Recombinant)

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

ADK Protein (Recombinant)

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

PTP4A2 Protein (Recombinant)

  • EUR 6397.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

PTPN7 Protein (Recombinant)

  • EUR 230.00
  • EUR 1483.00
  • EUR 328.00
  • 1 µg
  • 50 ug
  • 5 ug
  • Shipped within 5-10 working days.

PPP3CA Protein (Recombinant)

  • EUR 230.00
  • EUR 1609.00
  • EUR 328.00
  • 1 µg
  • 50 ug
  • 5 ug
  • Shipped within 5-10 working days.

PPP1CA Protein (Recombinant)

  • EUR 230.00
  • EUR 1609.00
  • EUR 328.00
  • 1 µg
  • 50 ug
  • 5 ug
  • Shipped within 5-10 working days.

ABHD14B Protein (Recombinant)

  • EUR 230.00
  • EUR 1609.00
  • EUR 328.00
  • 1 µg
  • 50 ug
  • 5 ug
  • Shipped within 5-10 working days.

PPP1CC Protein (Recombinant)

  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

PTPRC Protein (Recombinant)

  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

SCCA recombinant protein

E62C01501 20ug
EUR 382

SCCA1 recombinant protein

E62C01502 20ug
EUR 382

SCCA2 recombinant protein

E62C01503 20ug
EUR 382

P53 recombinant protein

E62C02301 20ug
EUR 382

DKK1 recombinant protein

E62C02401 20ug
EUR 382

Staphylokinase Recombinant Protein

PROTP68802 Regular: 100ug
EUR 317
Description: Staphylokinase Recombinant produced in E.Coli is a non-glycosylated polypeptide chain containing 136 amino acids and having a molecular weight of 16kDa.;The Staphylokinase is purified by proprietary chromatographic techniques.

TIAL1Human Recombinant Protein

PROTQ01085 Regular: 20ug
EUR 317
Description: TIAL1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 398 amino acids (1-375 a.a) and having a molecular mass of 44.0kDa.TIAL1 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

LIN7BHuman Recombinant Protein

PROTQ9HAP6 Regular: 10ug
EUR 317
Description: LIN7B Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 230 amino acids (1-207 a.a.) and having a molecular mass of 25.3kDa.;LIN7B is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

KIAA0513Human Recombinant Protein

PROTO60268 Regular: 10ug
EUR 317
Description: KIAA0513 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 424 amino acids (1-401 a.a) and having a molecular mass of 47.9kDa.;KIAA0513 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Batroxobin Recombinant Protein

PROTP04971 Regular: 10ug
EUR 317
Description: The Batroxobin Recombinant Protein, produced in yeast, is a single, glycosilated polypeptide chain containing 231 amino acids and having an Mw of approximately 28-33 kDa.

Lysostaphin Recombinant Protein

PROTP10547 Regular: 5mg
EUR 366
Description: Lysostaphin, an endopeptidase specific for the cell wall peptidoglycan of staphylococci, is an extremely potent anti-staphylococcal agent. Lysostaphin is used as a research and diagnostic tool. Because it lyses staphylococci efficiently, it is widely used when preparing staphylococcal DNA or other cellular components for genetic and biochemical studies and for the preparation of protoplasts for transformation. Preparation and analysis of bacterial DNA has become a powerful tool used by clinical and other microbiologists in epidemiological studies aimed at tracing sources of infection or bacterial contamination.;The Mw of lysostaphin is 26,921 (Recsei et al, PNAS 1987).

Streptavidin Recombinant Protein

PROTP22629-2 Regular: 20mg
EUR 317
Description: Streptavidin Streptomyces Avidinii Recombinant produced in E.Coli. ;The molecular weight per tetramer is approximately 52kDa.

Recombinant Echovirus Protein

VAng-Lsx0595-inquire inquire Ask for price
Description: Echovirus, recombinant protein from E. coli.

Recombinant RSV Protein

VAng-Lsx0448-inquire inquire Ask for price
Description: RSV, recombinant protein from Hep-2 Cells.

Recombinant Rotavirus Protein

VAng-Lsx0471-inquire inquire Ask for price
Description: RotaVirus, recombinant protein from MA 104 cells.

Recombinant SIV Protein

VAng-Lsx0493-inquire inquire Ask for price
Description: Recombinant SIV p55- Strains: SIV mac 23g and SIV smH4 is glycosylated with N-linked sugars and produced using baculovirus vectors in insect cells.

Recombinant Coxsackievirus Protein

VAng-Lsx0074-inquire inquire Ask for price
Description: Coxsackievirus antigen, recombinant protein from E. coli.

Recombinant EBV Protein

VAng-Lsx0108-inquire inquire Ask for price
Description: EBV, recombinant protein from human cells.

Recombinant EBOV Protein

VAng-Lsx0136-1mg 1 mg
EUR 1138
Description: EBOV, recombinant protein from E. coli.

Recombinant Hantavirus Protein

VAng-Lsx0152-100gEcoli 100 µg (E. coli)
EUR 670
Description: Hantavirus, recombinant protein from E. coli.

Recombinant Hantavirus Protein

VAng-Lsx0152-1mgEcoli 1 mg (E. coli)
EUR 3402
Description: Hantavirus, recombinant protein from E. coli.

Recombinant Hantavirus Protein

VAng-Lsx0152-500gEcoli 500 µg (E. coli)
EUR 1787
Description: Hantavirus, recombinant protein from E. coli.

Recombinant HBV Protein

VAng-Lsx0175-1mg 1 mg
EUR 3470
Description: HBV, recombinant protein from E. coli.

Recombinant HDV Protein

VAng-Lsx0220-inquire inquire Ask for price
Description: HDV, recombinant protein from E. coli.

TAGLN Recombinant Protein (Rat) (Recombinant- Tag)

RP232205 100 ug Ask for price

TAGLN2 Recombinant Protein (Rat) (Recombinant Tag)

RP232208 100 ug Ask for price

TAGLN3 Recombinant Protein (Rat) (Recombinant Tag)

RP232211 100 ug Ask for price

TAGLN3 Recombinant Protein (Rat) (Recombinant Tag)

RP232214 100 ug Ask for price

TAGAP Recombinant Protein (Human) (Recombinant- Tag)

RP043930 100 ug Ask for price

CTAGE3P Recombinant Protein (Human) (Recombinant Tag)

RP053400 100 ug Ask for price

CTAGE4 Recombinant Protein (Human) (Recombinant- Tag)

RP053403 100 ug Ask for price

CTAGE8 Recombinant Protein (Human) (Recombinant- Tag)

RP053409 100 ug Ask for price

CTAGE9 Recombinant Protein (Human) (Recombinant- Tag)

RP053412 100 ug Ask for price

STAG3L1 Recombinant Protein (Human) (Recombinant Tag)

RP030283 100 ug Ask for price

STAG3L2 Recombinant Protein (Human) (Recombinant Tag)

RP030286 100 ug Ask for price

STAG3L3 Recombinant Protein (Human) (Recombinant Tag)

RP030289 100 ug Ask for price

Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins within the vary from 1 to 100 kDa.

A discontinuous sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) system for the separation of proteins within the vary from 1 to 100 kDa is described. Tricine, used because the trailing ion, permits a decision of small proteins at decrease acrylamide concentrations than in glycine-SDS-PAGE techniques.

A superior decision of proteins, particularly within the vary between 5 and 20 kDa, is achieved with out the need to make use of urea. Proteins above 30 kDa are already destacked inside the pattern gel. Thus a easy passage of those proteins from pattern to separating gel is warranted and overloading results are lowered.

That is of particular significance when massive quantities of protein are to be loaded onto preparative gels. The omission of glycine and urea prevents disturbances which could happen in the middle of subsequent amino acid sequencing.

MaxQuant permits excessive peptide identification charges, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification.

Environment friendly evaluation of very massive quantities of uncooked information for peptide identification and protein quantification is a principal problem in mass spectrometry (MS)-based proteomics. Right here we describe MaxQuant, an built-in suite of algorithms particularly developed for high-resolution, quantitative MS information.

Utilizing correlation evaluation and graph principle, MaxQuant detects peaks, isotope clusters and steady amino acid isotope-labeled (SILAC) peptide pairs as three-dimensional objects in m/z, elution time and sign depth area. By integrating a number of mass measurements and correcting for linear and nonlinear mass offsets, we obtain mass accuracy within the p.p.b. vary, a sixfold improve over normal strategies.

STAG3L3 Recombinant Protein (Human) (Recombinant Tag)

We improve the proportion of recognized fragmentation spectra to 73% for SILAC peptide pairs through unambiguous task of isotope and missed-cleavage state and particular person mass precision. MaxQuant routinely quantifies a number of hundred thousand peptides per SILAC-proteome experiment and permits statistically strong identification and quantification of >4,000 proteins in mammalian cell lysates.




S100A3 Antibody
ABD13246 100 ug
EUR 438
S100A3 Antibody
ABD4354 100 ug
EUR 438
S100A3 antibody
70R-20062 50 ul
EUR 435
Description: Rabbit polyclonal S100A3 antibody
S100A3 antibody
70R-1096 100 ug
EUR 377
Description: Rabbit polyclonal S100A3 antibody raised against the N terminal of S100A3
S100A3 Antibody
DF4354 200ul
EUR 304
Description: S100A3 Antibody detects endogenous levels of total S100A3.
S100A3 siRNA
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
S100A3 siRNA
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
S100A3 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against S100A3. Recognizes S100A3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000
S100A3 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against S100A3. Recognizes S100A3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
S100A3 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against S100A3. Recognizes S100A3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
YF-PA24646 50 ul
EUR 334
Description: Mouse polyclonal to S100A3
S100A3 cloning plasmid
CSB-CL020631HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 306
  • Sequence: atggccaggcctctggagcaggcggtagctgccatcgtgtgcaccttccaggaatacgcagggcgctgtggggacaaatacaagctctgccaggcggagctcaaggagctgctgcagaaggagctggccacctggaccccgactgagtttcgggaatgtgactacaacaaattcat
  • Show more
Description: A cloning plasmid for the S100A3 gene.
anti- S100A3 antibody
FNab07559 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: S100 calcium binding protein A3
  • Uniprot ID: P33764
  • Gene ID: 6274
  • Research Area: Cancer, Immunology
Description: Antibody raised against S100A3
S100A3 Rabbit pAb
A4102-100ul 100 ul
EUR 308
S100A3 Rabbit pAb
A4102-200ul 200 ul
EUR 459
S100A3 Rabbit pAb
A4102-20ul 20 ul
EUR 183
S100A3 Rabbit pAb
A4102-50ul 50 ul
EUR 223
S100A3 Blocking Peptide
33R-5733 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of S100A3 antibody, catalog no. 70R-1096
S100A3 Polyclonal Antibody
30520-100ul 100ul
EUR 252
S100A3 Polyclonal Antibody
30520-50ul 50ul
EUR 187
Human S100A3 antibody
32880-05111 150 ug
EUR 261
S100A3 Blocking Peptide
DF4354-BP 1mg
EUR 195
Anti-S100A3 antibody
PAab07559 100 ug
EUR 412
PVT13675 2 ug
EUR 391
Anti-S100A3 antibody
STJ25430 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein has the highest content of cysteines of all S100 proteins, has a high affinity for Zinc, and is highly expressed in human hair cuticle. The precise function of this protein is unknown.
Anti-S100A3 (1D4)
YF-MA15308 100 ug
EUR 363
Description: Mouse monoclonal to S100A3
S100A3 Polyclonal Conjugated Antibody
C30520 100ul
EUR 397
Rat S100A3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
S100A3 ELISA KIT|Human
EF002690 96 Tests
EUR 689
Human S100A3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
S100A3 protein (His tag)
80R-1834 100 ug
EUR 305
Description: Purified recombinant S100A3 protein
S100A3 protein (His tag)
80R-2395 100 ug
EUR 322
Description: Purified recombinant Mouse S100A3 protein (His tag)
Mouse S100A3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human S100A3 antibody (Biotin Conjugate)
32880-05121 150 ug
EUR 369
Human Protein S100-A3 (S100A3)
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 38.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein S100-A3(S100A3) expressed in E.coli
S100A3 ORF Vector (Human) (pORF)
ORF009167 1.0 ug DNA
EUR 95
S100a3 ORF Vector (Mouse) (pORF)
ORF056605 1.0 ug DNA
EUR 506
S100a3 ORF Vector (Rat) (pORF)
ORF075787 1.0 ug DNA
EUR 506
Polyclonal S100A3 / S100E Antibody (aa26-75)
AMM07707G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human S100A3 / S100E (aa26-75). This antibody is tested and proven to work in the following applications:
Polyclonal S100A3 antibody - N-terminal region
AMM07718G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human S100A3 - N-terminal region. This antibody is tested and proven to work in the following applications:
Human S100A3 AssayLite Antibody (FITC Conjugate)
32880-05141 150 ug
EUR 428
Human S100A3 AssayLite Antibody (RPE Conjugate)
32880-05151 150 ug
EUR 428
Human S100A3 AssayLite Antibody (APC Conjugate)
32880-05161 150 ug
EUR 428
Human S100A3 AssayLite Antibody (PerCP Conjugate)
32880-05171 150 ug
EUR 471
S100A3 sgRNA CRISPR Lentivector set (Human)
K2082401 3 x 1.0 ug
EUR 339
S100a3 sgRNA CRISPR Lentivector set (Mouse)
K3420501 3 x 1.0 ug
EUR 339
S100a3 sgRNA CRISPR Lentivector set (Rat)
K7113101 3 x 1.0 ug
EUR 339
Monoclonal S100A3 Antibody (monoclonal) (M01), Clone: 1D4
AMM07708G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human S100A3 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1D4. This antibody is applicable in WB
Human Protein S100- A3, S100A3 ELISA KIT
ELI-53357h 96 Tests
EUR 824
Mouse Protein S100- A3, S100a3 ELISA KIT
ELI-41458m 96 Tests
EUR 865
S100 Calcium Binding Protein A3 (S100A3) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
S100 Calcium Binding Protein A3 (S100A3) Antibody
  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.
S100 Calcium Binding Protein A3 (S100A3) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
S100 Calcium Binding Protein A3 (S100A3) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
S100 Calcium Binding Protein A3 (S100A3) Antibody
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
S100 Calcium Binding Protein A3 (S100A3) Antibody
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
S100 Calcium Binding Protein A3 (S100A3) Antibody
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
S100 Calcium Binding Protein A3 (S100A3) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
S100 Calcium Binding Protein A3 (S100A3) Antibody
abx237559-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
S100A3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2082402 1.0 ug DNA
EUR 154
S100A3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2082403 1.0 ug DNA
EUR 154
S100A3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2082404 1.0 ug DNA
EUR 154
S100a3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3420502 1.0 ug DNA
EUR 154
S100a3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3420503 1.0 ug DNA
EUR 154
S100a3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3420504 1.0 ug DNA
EUR 154
Human Protein S100-A3(S100A3) ELISA kit
CSB-EL020631HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein S100-A3 (S100A3) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Protein S100-A3(S100A3) ELISA kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein S100-A3(S100A3) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
S100a3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7113102 1.0 ug DNA
EUR 154
S100a3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7113103 1.0 ug DNA
EUR 154
S100a3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7113104 1.0 ug DNA
EUR 154
S100A3 Protein Vector (Human) (pPB-C-His)
PV036665 500 ng
EUR 329
S100A3 Protein Vector (Human) (pPB-N-His)
PV036666 500 ng
EUR 329
S100A3 Protein Vector (Human) (pPM-C-HA)
PV036667 500 ng
EUR 329
S100A3 Protein Vector (Human) (pPM-C-His)
PV036668 500 ng
EUR 329
Recombinant S100 Calcium Binding Protein A3 (S100A3)
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P33764
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human S100 Calcium Binding Protein A3 expressed in: E.coli
Recombinant S100 Calcium Binding Protein A3 (S100A3)
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P62819
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat S100 Calcium Binding Protein A3 expressed in: E.coli
Recombinant Mouse S100A3 Protein, His, E.coli-1mg
QP13393-1mg 1mg
EUR 2757
Recombinant Mouse S100A3 Protein, His, E.coli-20ug
QP13393-20ug 20ug
EUR 201
Recombinant Mouse S100A3 Protein, His, E.coli-5ug
QP13393-5ug 5ug
EUR 155
S100A3 Protein Vector (Rat) (pPB-C-His)
PV303146 500 ng
EUR 603
S100A3 Protein Vector (Rat) (pPB-N-His)
PV303147 500 ng
EUR 603
S100A3 Protein Vector (Rat) (pPM-C-HA)
PV303148 500 ng
EUR 603
S100A3 Protein Vector (Rat) (pPM-C-His)
PV303149 500 ng
EUR 603