Identifiers Aliases of Signal transducer and activator of transcription 1 (STAT1) is STAT1

Signal transducer and activator of transcription 1 (STAT1) Identifiers Aliases is STAT1 a transcription factor which in humans is encoded by the STAT1 gene. It is a member of the STAT protein family And its one of Aliases is STAT1.

All STAT molecules are phosphorylated by receptor associated kinases, that causes activation, dimerization by forming homo- or heterodimers and finally translocate to nucleus to work as transcription factors. 

Its one of Identifiers Aliases is STAT1 Specifically STAT1 can be activated by several ligands such as Interferon alpha (IFNa), Interferon gamma (IFNg), Epidermal Growth Factor (EGF), Platelet Derived Growth Factor (PDGF) or Interleukin 6 (IL-6).

Mouse Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit
DLR-STAT1-Mu-48T 48T
EUR 508
  • Should the Mouse Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Signal Transducer And Activator Of Transcription 1 (STAT1) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit
DLR-STAT1-Mu-96T 96T
EUR 661
  • Should the Mouse Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Signal Transducer And Activator Of Transcription 1 (STAT1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit
RD-STAT1-Hu-48Tests 48 Tests
EUR 500
Human Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit
RD-STAT1-Hu-96Tests 96 Tests
EUR 692
Mouse Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit
RD-STAT1-Mu-48Tests 48 Tests
EUR 511
Mouse Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit
RD-STAT1-Mu-96Tests 96 Tests
EUR 709
Human Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit
RDR-STAT1-Hu-48Tests 48 Tests
EUR 522
Human Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit
RDR-STAT1-Hu-96Tests 96 Tests
EUR 724
Mouse Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit
RDR-STAT1-Mu-48Tests 48 Tests
EUR 534
Mouse Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit
RDR-STAT1-Mu-96Tests 96 Tests
EUR 742
STAT1 Antibody
AF6300 200ul
EUR 304
Description: STAT1 Antibody detects endogenous levels of total STAT1.
STAT1 Antibody
AF7801 200ul
EUR 376
Description: STAT1 Antibody detects endogenous levels of STAT1.
STAT1 protein
E20-80097 20ug
EUR 408
STAT1 Antibody
ABF6300 100 ug
EUR 438
STAT1 antibody
70R-50428 100 ul
EUR 287
Description: Purified Polyclonal STAT1 antibody
STAT1 antibody
70R-50429 100 ul
EUR 244
Description: Purified Polyclonal STAT1 antibody
STAT1 antibody
70R-50430 100 ul
EUR 244
Description: Purified Polyclonal STAT1 antibody
STAT1 antibody
70R-51641 100 ul
EUR 244
Description: Purified Polyclonal STAT1 antibody
STAT1 antibody
70R-37484 100 ug
EUR 273
Description: Rabbit Polyclonal STAT1 antibody
STAT1 antibody
70R-32509 100 ug
EUR 327
Description: Rabbit polyclonal STAT1 antibody
STAT1 antibody
70R-32511 100 ug
EUR 327
Description: Rabbit polyclonal STAT1 antibody
STAT1 antibody
70R-31715 100 ug
EUR 327
Description: Rabbit polyclonal STAT1 antibody
STAT1 Antibody
ABD6001 100 ug
EUR 438
STAT1 Antibody
33768-100ul 100ul
EUR 252
STAT1 Antibody
33768-50ul 50ul
EUR 187
STAT1 Antibody
48752-100ul 100ul
EUR 333
STAT1 Antibody
48752-50ul 50ul
EUR 239
STAT1 Antibody
48209-100ul 100ul
EUR 333
STAT1 Antibody
48209-50ul 50ul
EUR 239
STAT1 antibody
10R-5952 100 ul
EUR 691
Description: Mouse monoclonal STAT1 antibody
STAT1 antibody
10R-5953 100 ul
EUR 726
Description: Mouse monoclonal STAT1 antibody
STAT1 antibody
10R-5954 100 ul
EUR 691
Description: Mouse monoclonal STAT1 antibody
STAT1 antibody
10R-5955 100 ul
EUR 691
Description: Mouse monoclonal STAT1 antibody
STAT1 antibody
10R-8671 50 ul
EUR 219
Description: Mouse monoclonal STAT1 antibody
Stat1 Antibody
EUR 316
Stat1 Antibody
EUR 146
STAT1 Antibody
32001-100ul 100ul
EUR 252
STAT1 antibody
10R-1754 100 ug
EUR 512
Description: Mouse monoclonal STAT1 antibody
STAT1 antibody
20R-1467 100 ug
EUR 673
Description: Rabbit polyclonal STAT1 antibody
STAT1 antibody
20R-1910 50 ug
EUR 281
Description: Rabbit polyclonal STAT1 antibody
STAT1 antibody
20R-2013 50 ug
EUR 281
Description: Rabbit polyclonal STAT1 antibody
STAT1 antibody
20R-2226 50 ug
EUR 281
Description: Rabbit polyclonal STAT1 antibody
STAT1 antibody
20R-2344 50 ug
EUR 281
Description: Rabbit polyclonal STAT1 antibody
STAT1 antibody
70R-20571 50 ul
EUR 435
Description: Rabbit polyclonal STAT1 antibody
STAT1 antibody
70R-13759 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal STAT1 antibody
STAT1 antibody
70R-14047 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal STAT1 antibody
STAT1 antibody
70R-11633 100 ug
EUR 403
Description: Rabbit polyclonal STAT1 antibody
STAT1 Antibody
DF6001 200ul
EUR 304
Description: STAT1 Antibody detects endogenous levels of total STAT1.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
STAT1 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000
STAT1 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000
STAT1 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IP, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IP:2-5ug/mglysate.ELISA:1/10000
STAT1 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
STAT1 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:500-1:2000, WB:1:250-1:1000, IHC:1:15-1:60
STAT1 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100
STAT1 Antibody
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
STAT1 Antibody
CSB-PA697883-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
STAT1 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:200-500
STAT1 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
STAT1 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
STAT1 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
STAT1 antibody
PAab09985 100 ug
EUR 386
PVT13308 2 ug
EUR 391
YF-PA14812 50 ug
EUR 363
Description: Mouse polyclonal to STAT1
YF-PA14813 100 ug
EUR 403
Description: Rabbit polyclonal to STAT1
YF-PA24779 50 ul
EUR 334
Description: Mouse polyclonal to STAT1
YF-PA27370 100 ul
EUR 403
Description: Rabbit polyclonal to STAT1
STAT1 Blocking Peptide
AF6300-BP 1mg
EUR 195
Polyclonal STAT1 Antibody
APR10258G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STAT1 . This antibody is tested and proven to work in the following applications:
Monoclonal STAT1 Antibody
APR10259G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human STAT1. The antibodies are raised in Mouse. This antibody is applicable in WB, IP
STAT1 Blocking Peptide
AF7801-BP 1mg
EUR 195
STAT1 cloning plasmid
CSB-CL022810HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2139
  • Sequence: atgtctcagtggtacgaacttcagcagcttgactcaaaattcctggagcaggttcaccagctttatgatgacagttttcccatggaaatcagacagtacctggcacagtggttagaaaagcaagactgggagcacgctgccaatgatgtttcatttgccaccatccgttttcatg
  • Show more
Description: A cloning plasmid for the STAT1 gene.
STAT1 Polyclonal Antibody
EA226-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against STAT1 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC
STAT1 Polyclonal Antibody
EA226-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against STAT1 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC
anti- STAT1 antibody
FNab09985 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:500
  • Immunogen: signal transducer and activator of transcription 1, 91kDa
  • Uniprot ID: P42224
  • Gene ID: 6772
  • Research Area: Epigenetics, Signal Transduction, Metabolism, Cardiovascular, Immunology
Description: Antibody raised against STAT1
Stat1 Polyclonal Antibody
ES8255-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Stat1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
Stat1 Polyclonal Antibody
ES8255-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Stat1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
Stat1 Polyclonal Antibody
ES3507-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Stat1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
Stat1 Polyclonal Antibody
ES3507-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Stat1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
Stat1 Polyclonal Antibody
ES3508-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Stat1 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, IP, WB, ELISA