Signal transducer and activator of transcription 1 (STAT1) Identifiers Aliases is STAT1 a transcription factor which in humans is encoded by the STAT1 gene. It is a member of the STAT protein family And its one of Aliases is STAT1.
All STAT molecules are phosphorylated by receptor associated kinases, that causes activation, dimerization by forming homo- or heterodimers and finally translocate to nucleus to work as transcription factors.
Its one of Identifiers Aliases is STAT1 Specifically STAT1 can be activated by several ligands such as Interferon alpha (IFNa), Interferon gamma (IFNg), Epidermal Growth Factor (EGF), Platelet Derived Growth Factor (PDGF) or Interleukin 6 (IL-6).
Mouse Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit |
DLR-STAT1-Mu-48T |
DL Develop |
48T |
EUR 508.00 |
- Should the Mouse Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Signal Transducer And Activator Of Transcription 1 (STAT1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit |
DLR-STAT1-Mu-96T |
DL Develop |
96T |
EUR 661.00 |
- Should the Mouse Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Signal Transducer And Activator Of Transcription 1 (STAT1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit |
RD-STAT1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500.00 |
Human Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit |
RD-STAT1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692.00 |
Mouse Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit |
RD-STAT1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511.00 |
Mouse Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit |
RD-STAT1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709.00 |
Human Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit |
RDR-STAT1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522.00 |
Human Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit |
RDR-STAT1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724.00 |
Mouse Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit |
RDR-STAT1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 534.00 |
Mouse Signal Transducer And Activator Of Transcription 1 (STAT1) ELISA Kit |
RDR-STAT1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 742.00 |
STAT1 Antibody |
AF6300 |
Affbiotech |
200ul |
EUR 304.00 |
Description: STAT1 Antibody detects endogenous levels of total STAT1. |
STAT1 Antibody |
AF7801 |
Affbiotech |
200ul |
EUR 376.00 |
Description: STAT1 Antibody detects endogenous levels of STAT1. |
STAT1 protein |
E20-80097 |
EnoGene |
20ug |
EUR 408.00 |
STAT1 antibody |
70R-50428 |
Fitzgerald |
100 ul |
EUR 287.00 |
Description: Purified Polyclonal STAT1 antibody |
STAT1 antibody |
70R-50429 |
Fitzgerald |
100 ul |
EUR 244.00 |
Description: Purified Polyclonal STAT1 antibody |
STAT1 antibody |
70R-50430 |
Fitzgerald |
100 ul |
EUR 244.00 |
Description: Purified Polyclonal STAT1 antibody |
STAT1 antibody |
70R-51641 |
Fitzgerald |
100 ul |
EUR 244.00 |
Description: Purified Polyclonal STAT1 antibody |
STAT1 antibody |
70R-37484 |
Fitzgerald |
100 ug |
EUR 273.00 |
Description: Rabbit Polyclonal STAT1 antibody |
STAT1 antibody |
70R-32509 |
Fitzgerald |
100 ug |
EUR 327.00 |
Description: Rabbit polyclonal STAT1 antibody |
STAT1 antibody |
70R-32511 |
Fitzgerald |
100 ug |
EUR 327.00 |
Description: Rabbit polyclonal STAT1 antibody |
STAT1 antibody |
70R-31715 |
Fitzgerald |
100 ug |
EUR 327.00 |
Description: Rabbit polyclonal STAT1 antibody |
STAT1 Antibody |
33768-100ul |
SAB |
100ul |
EUR 252.00 |
STAT1 Antibody |
33768-50ul |
SAB |
50ul |
EUR 187.00 |
STAT1 Antibody |
48752-100ul |
SAB |
100ul |
EUR 333.00 |
STAT1 Antibody |
48752-50ul |
SAB |
50ul |
EUR 239.00 |
STAT1 Antibody |
48209-100ul |
SAB |
100ul |
EUR 333.00 |
STAT1 Antibody |
48209-50ul |
SAB |
50ul |
EUR 239.00 |
STAT1 antibody |
10R-5952 |
Fitzgerald |
100 ul |
EUR 691.00 |
Description: Mouse monoclonal STAT1 antibody |
STAT1 antibody |
10R-5953 |
Fitzgerald |
100 ul |
EUR 726.00 |
Description: Mouse monoclonal STAT1 antibody |
STAT1 antibody |
10R-5954 |
Fitzgerald |
100 ul |
EUR 691.00 |
Description: Mouse monoclonal STAT1 antibody |
STAT1 antibody |
10R-5955 |
Fitzgerald |
100 ul |
EUR 691.00 |
Description: Mouse monoclonal STAT1 antibody |
STAT1 antibody |
10R-8671 |
Fitzgerald |
50 ul |
EUR 219.00 |
Description: Mouse monoclonal STAT1 antibody |
Stat1 Antibody |
3133R-100 |
Biovision |
|
EUR 316.00 |
Stat1 Antibody |
3133R-30T |
Biovision |
|
EUR 146.00 |
STAT1 Antibody |
32001-100ul |
SAB |
100ul |
EUR 252.00 |
STAT1 antibody |
10R-1754 |
Fitzgerald |
100 ug |
EUR 512.00 |
Description: Mouse monoclonal STAT1 antibody |
STAT1 antibody |
20R-1467 |
Fitzgerald |
100 ug |
EUR 673.00 |
Description: Rabbit polyclonal STAT1 antibody |
STAT1 antibody |
20R-1910 |
Fitzgerald |
50 ug |
EUR 281.00 |
Description: Rabbit polyclonal STAT1 antibody |
STAT1 antibody |
20R-2013 |
Fitzgerald |
50 ug |
EUR 281.00 |
Description: Rabbit polyclonal STAT1 antibody |
STAT1 antibody |
20R-2226 |
Fitzgerald |
50 ug |
EUR 281.00 |
Description: Rabbit polyclonal STAT1 antibody |
STAT1 antibody |
20R-2344 |
Fitzgerald |
50 ug |
EUR 281.00 |
Description: Rabbit polyclonal STAT1 antibody |
STAT1 antibody |
70R-20571 |
Fitzgerald |
50 ul |
EUR 435.00 |
Description: Rabbit polyclonal STAT1 antibody |
STAT1 antibody |
70R-13759 |
Fitzgerald |
100 ug |
EUR 322.00 |
Description: Affinity purified Rabbit polyclonal STAT1 antibody |
STAT1 antibody |
70R-14047 |
Fitzgerald |
100 ug |
EUR 322.00 |
Description: Affinity purified Rabbit polyclonal STAT1 antibody |
STAT1 antibody |
70R-11633 |
Fitzgerald |
100 ug |
EUR 403.00 |
Description: Rabbit polyclonal STAT1 antibody |
STAT1 Antibody |
DF6001 |
Affbiotech |
200ul |
EUR 304.00 |
Description: STAT1 Antibody detects endogenous levels of total STAT1. |
STAT1 siRNA |
20-abx935406 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
STAT1 Antibody |
1-CSB-PA006102 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000 |
STAT1 Antibody |
1-CSB-PA004167 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000 |
STAT1 Antibody |
1-CSB-PA004168 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IP, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IP:2-5ug/mglysate.ELISA:1/10000 |
STAT1 Antibody |
1-CSB-PA004169 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000 |
STAT1 Antibody |
1-CSB-PA563679 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:500-1:2000, WB:1:250-1:1000, IHC:1:15-1:60 |
STAT1 Antibody |
1-CSB-PA582088 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100 |
STAT1 Antibody |
CSB-PA697883- |
Cusabio |
|
EUR 335.00 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
STAT1 Antibody |
CSB-PA697883-100ul |
Cusabio |
100ul |
EUR 316.00 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
STAT1 Antibody |
1-CSB-PA080236 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
|
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:200-500 |
STAT1 Antibody |
1-CSB-PA022810GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
STAT1 Antibody |
1-CSB-PA022810HA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
STAT1 Antibody |
1-CSB-PA022810LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against STAT1. Recognizes STAT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
anti-STAT1 |
YF-PA14812 |
Abfrontier |
50 ug |
EUR 363.00 |
Description: Mouse polyclonal to STAT1 |
anti-STAT1 |
YF-PA14813 |
Abfrontier |
100 ug |
EUR 403.00 |
Description: Rabbit polyclonal to STAT1 |
anti-STAT1 |
YF-PA24779 |
Abfrontier |
50 ul |
EUR 334.00 |
Description: Mouse polyclonal to STAT1 |
anti-STAT1 |
YF-PA27370 |
Abfrontier |
100 ul |
EUR 403.00 |
Description: Rabbit polyclonal to STAT1 |
STAT1 Blocking Peptide |
AF6300-BP |
Affbiotech |
1mg |
EUR 195.00 |
Polyclonal STAT1 Antibody |
APR10258G |
Leading Biology |
0.1 mg |
EUR 659.00 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STAT1 . This antibody is tested and proven to work in the following applications: |
Monoclonal STAT1 Antibody |
APR10259G |
Leading Biology |
0.1ml |
EUR 484.00 |
Description: A Monoclonal antibody against Human STAT1. The antibodies are raised in Mouse. This antibody is applicable in WB, IP |
STAT1 Blocking Peptide |
AF7801-BP |
Affbiotech |
1mg |
EUR 195.00 |
STAT1 cloning plasmid |
CSB-CL022810HU-10ug |
Cusabio |
10ug |
EUR 474.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2139
- Sequence: atgtctcagtggtacgaacttcagcagcttgactcaaaattcctggagcaggttcaccagctttatgatgacagttttcccatggaaatcagacagtacctggcacagtggttagaaaagcaagactgggagcacgctgccaatgatgtttcatttgccaccatccgttttcatg
- Show more
|
Description: A cloning plasmid for the STAT1 gene. |
STAT1 Polyclonal Antibody |
EA226-100ul |
ELK Biotech |
100ul |
EUR 279.00 |
Description: A Rabbit Polyclonal antibody against STAT1 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC |
STAT1 Polyclonal Antibody |
EA226-50ul |
ELK Biotech |
50ul |
EUR 207.00 |
Description: A Rabbit Polyclonal antibody against STAT1 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC |
anti- STAT1 antibody |
FNab09985 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:2000
- IHC: 1:50-1:500
- Immunogen: signal transducer and activator of transcription 1, 91kDa
- Uniprot ID: P42224
- Gene ID: 6772
- Research Area: Epigenetics, Signal Transduction, Metabolism, Cardiovascular, Immunology
|
Description: Antibody raised against STAT1 |
Stat1 Polyclonal Antibody |
ES8255-100ul |
ELK Biotech |
100ul |
EUR 279.00 |
Description: A Rabbit Polyclonal antibody against Stat1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
Stat1 Polyclonal Antibody |
ES8255-50ul |
ELK Biotech |
50ul |
EUR 207.00 |
Description: A Rabbit Polyclonal antibody against Stat1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
Stat1 Polyclonal Antibody |
ES3507-100ul |
ELK Biotech |
100ul |
EUR 279.00 |
Description: A Rabbit Polyclonal antibody against Stat1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Stat1 Polyclonal Antibody |
ES3507-50ul |
ELK Biotech |
50ul |
EUR 207.00 |
Description: A Rabbit Polyclonal antibody against Stat1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Stat1 Polyclonal Antibody |
ES3508-100ul |
ELK Biotech |
100ul |
EUR 279.00 |
Description: A Rabbit Polyclonal antibody against Stat1 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, IP, WB, ELISA |