Excessive decision two-dimensional electrophoresis of proteins
A way has been developed for the separation of proteins by two-dimensional polyacrylamide gel electrophoresis. Attributable to its decision and sensitivity, this
method is a strong software for the evaluation and detection of proteins from advanced organic sources.
Proteins are separated in response to isoelectric level by isoelectric focusing within the first dimension, and in response to molecular weight by sodium dodecyl sulfate electrophoresis within the second dimension. Since these two parameters are unrelated, it’s potential to acquire an virtually uniform distribution of protein spots throughout a two-diminsional gel.
Serine/Threonine-Protein Kinase N1 (PKN1) Antibody
|
This system has resolved 1100 completely different elements from Escherichia coli and needs to be able to resolving a most of 5000 proteins. A protein containing as little as one disintegration per min of both 14C or 35S might be detected by autoradiography.
A protein which constitutes 10 minus four to 10 minus 5% of the entire protein might be detected and quantified by autoradiography. The reproducibility of the separation is enough to allow every spot on one separation to be matched with a spot on a special separation.
This system offers a technique for estimation (on the described sensitivities) of the variety of proteins made by any organic system. This method can resolve proteins differing in a single cost and consequently can be utilized within the evaluation of in vivo modifications leading to a change in cost. Proteins whose cost is modified by missense mutations might be recognized. An in depth description of the strategies in addition to the traits of this method are offered.

stat-2
Recombinant EBV EBNA1 Protein, His, E.coli-100ug
|
Recurrent urinary tract infections (rUTI) are a crucial sickness associated to morbidities and mortality. Resistance to the same old of care antibiotics is now widespread as a result of continued use of antibiotics amongst people who endure from rUTI.
- We’re subsequently making a vaccine to forestall recurrences amongst victims with rUTI. The antigen of the vaccine is FimH, a bacterial adhesin protein, and the vaccine is adjuvanted with a TLR-4 agonist.
- In a Part 1 scientific look at evaluating the vaccine, immunized individuals produced FimH-binding antibodies. Proper right here we describe the optimization, qualification, and use of an assay to judge the efficiency of these anti-FimH antibodies.
- The suitability of the assay for its supposed perform was demonstrated by selectivity, specificity, sensitivity, and intra-assay and inter-assay precision.
- The acceptance requirements have been achieved for all parameters along with intra-assay precision with ≤10% relative regular deviations and inter-assay precision with ≤25% relative regular deviations. The outcomes provided herein advocate this handy assay will most likely be needed for supporting the vaccine’s efficacy in future human analysis.
- Furthermore and of good significance, these outcomes present that vaccine-induced helpful antibodies could also be elicited in rUTI victims in the direction of an important virulence situation, FimH.
Anti-PKN1 antibody |
STJ190147 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PKN1 |
anti-PKN1 |
YF-PA13997 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to PKN1 |
anti-PKN1 |
YF-PA13998 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to PKN1 |
anti-PKN1 |
YF-PA27338 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to PKN1 |
Human Protein Kinase N1 (PKN1) ELISA Kit |
DLR-PKN1-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Protein Kinase N1 (PKN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Kinase N1 (PKN1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Protein Kinase N1 (PKN1) ELISA Kit |
DLR-PKN1-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Protein Kinase N1 (PKN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Kinase N1 (PKN1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Protein Kinase N1 (PKN1) ELISA Kit |
RDR-PKN1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Protein Kinase N1 (PKN1) ELISA Kit |
RDR-PKN1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Protein Kinase N1 (PKN1) ELISA Kit |
RD-PKN1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Protein Kinase N1 (PKN1) ELISA Kit |
RD-PKN1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Rabbit Polyclonal antibody Anti-CRBN |
Anti-CRBN |
ImmunoStep |
50 µg |
EUR 349 |
Anti-PKN1 (1B10) |
YF-MA14890 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PKN1 |
Anti-PKN1 (1A4) |
YF-MA14891 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PKN1 |
PKN1 Antibody |
48392-100ul |
SAB |
100ul |
EUR 333 |
PKN1 Antibody |
48392-50ul |
SAB |
50ul |
EUR 239 |
PKN1 Antibody |
DF4790 |
Affbiotech |
200ul |
EUR 304 |
Description: PKN1 Antibody detects endogenous levels of total PKN1. |
PKN1 Antibody |
1-CSB-PA030259 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against PKN1. Recognizes PKN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
PKN1 antibody |
70R-50256 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal PKN1 antibody |
PKN1/PRK1 Antibody |
35295-100ul |
SAB |
100ul |
EUR 252 |
PKN1/PRK1 Antibody |
35295-50ul |
SAB |
50ul |
EUR 187 |
PKN1 Conjugated Antibody |
C48392 |
SAB |
100ul |
EUR 397 |
PKN1 Polyclonal Antibody |
ABP59926-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
- Applications tips:
|
Description: A polyclonal antibody for detection of PKN1 from Human, Mouse, Rat. This PKN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800 |
PKN1 Polyclonal Antibody |
ABP59926-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
- Applications tips:
|
Description: A polyclonal antibody for detection of PKN1 from Human, Mouse, Rat. This PKN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800 |
PKN1 Polyclonal Antibody |
ABP59926-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
- Applications tips:
|
Description: A polyclonal antibody for detection of PKN1 from Human, Mouse, Rat. This PKN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800 |
PKN1 Polyclonal Antibody |
ES8989-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PKN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PKN1 Polyclonal Antibody |
ES8989-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PKN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PKN1 siRNA |
20-abx904045 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PKN1 siRNA |
20-abx928745 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PKN1 siRNA |
20-abx928746 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PKN1/PRK1 Conjugated Antibody |
C35295 |
SAB |
100ul |
EUR 397 |
Polyclonal Goat anti-GST α-form |
GST-ANTI-1 |
Detroit R&D |
50 uL |
EUR 280 |
Polyclonal Goat anti-GST μ-form |
GST-ANTI-2 |
Detroit R&D |
50 uL |
EUR 280 |
Polyclonal Goat anti-GST p-form |
GST-ANTI-3 |
Detroit R&D |
50 uL |
EUR 280 |
PKN1 Rabbit pAb |
A0553-100ul |
Abclonal |
100 ul |
EUR 308 |
PKN1 Rabbit pAb |
A0553-200ul |
Abclonal |
200 ul |
EUR 459 |
PKN1 Rabbit pAb |
A0553-20ul |
Abclonal |
20 ul |
EUR 183 |
PKN1 Rabbit pAb |
A0553-50ul |
Abclonal |
50 ul |
EUR 223 |
PKN1 Blocking Peptide |
DF4790-BP |
Affbiotech |
1mg |
EUR 195 |
PKN1 Blocking Peptide |
20-abx063131 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PKN1 cloning plasmid |
CSB-CL623082HU-10ug |
Cusabio |
10ug |
EUR 902 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2829
- Sequence: atggccagcgacgccgtgcagagtgagcctcgcagctggtccctgctagagcagctgggcctggccggggcagacctggcggcccccggggtacagcagcagctggagctggagcgggagcggctgcggcgggaaatccgcaaggagctgaagctgaaggagggtgctgagaacc
- Show more
|
Description: A cloning plasmid for the PKN1 gene. |
Protein Kinase N1 (PKN1) Antibody |
20-abx008827 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Protein Kinase N1 (PKN1) Antibody |
20-abx101658 |
Abbexa |
-
EUR 300.00
-
EUR 133.00
-
EUR 746.00
-
EUR 398.00
-
EUR 258.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Protein Kinase N1 (PKN1) Antibody |
20-abx135704 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Protein Kinase N1 (PKN1) Antibody |
20-abx174267 |
Abbexa |
|
|
|
Monoclonal PKN1 Antibody, Clone: EPR3238 |
AMM07214G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human PKN1. The antibodies are raised in Rabbit and are from clone EPR3238. This antibody is applicable in WB, FC |
Monoclonal PKN1 Antibody, Clone: 4H10B1 |
AMM03009G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human PKN1. The antibodies are raised in Mouse and are from clone 4H10B1. This antibody is applicable in WB and IHC, FC, ICC, E |
Antibody for Human PKN1 (pThr774) |
SPC-1065D |
Stressmarq |
0.1ml |
EUR 354 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is unconjugated. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-A390 |
Stressmarq |
0.1ml |
EUR 401 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 390. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-A488 |
Stressmarq |
0.1ml |
EUR 400 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 488. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-A565 |
Stressmarq |
0.1ml |
EUR 400 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 565. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-A594 |
Stressmarq |
0.1ml |
EUR 400 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 594. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-A633 |
Stressmarq |
0.1ml |
EUR 400 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 633. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-A655 |
Stressmarq |
0.1ml |
EUR 400 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 655. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-A680 |
Stressmarq |
0.1ml |
EUR 400 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 680. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-A700 |
Stressmarq |
0.1ml |
EUR 400 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 700. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-ALP |
Stressmarq |
0.1ml |
EUR 394 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Alkaline Phosphatase. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-APC |
Stressmarq |
0.1ml |
EUR 399 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to APC . |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-APCCY7 |
Stressmarq |
0.1ml |
EUR 471 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to APC/Cy7. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-BI |
Stressmarq |
0.1ml |
EUR 396 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Biotin. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-DY350 |
Stressmarq |
0.1ml |
EUR 475 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 350. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-DY405 |
Stressmarq |
0.1ml |
EUR 452 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 405. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-DY488 |
Stressmarq |
0.1ml |
EUR 432 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 488. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-DY594 |
Stressmarq |
0.1ml |
EUR 436 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 594. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-DY633 |
Stressmarq |
0.1ml |
EUR 426 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 633. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-FITC |
Stressmarq |
0.1ml |
EUR 392 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to FITC. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-HRP |
Stressmarq |
0.1ml |
EUR 388 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to HRP. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-P594 |
Stressmarq |
0.1ml |
EUR 407 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to PE/ATTO 594. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-PCP |
Stressmarq |
0.1ml |
EUR 399 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to PerCP. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-RPE |
Stressmarq |
0.1ml |
EUR 397 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to RPE . |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-STR |
Stressmarq |
0.1ml |
EUR 398 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Streptavidin. |
Human PKN1 ELISA Kit |
EHP0125 |
Abclonal |
96Tests |
EUR 521 |
Bovine PKN1 ELISA Kit |
EBP0125 |
Abclonal |
96Tests |
EUR 521 |
Anserini PKN1 ELISA Kit |
EAP0125 |
Abclonal |
96Tests |
EUR 521 |
Canine PKN1 ELISA Kit |
ECP0125 |
Abclonal |
96Tests |
EUR 521 |
Goat PKN1 ELISA Kit |
EGTP0125 |
Abclonal |
96Tests |
EUR 521 |
Rat PKN1 shRNA Plasmid |
20-abx985442 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PKN1 shRNA Plasmid |
20-abx953755 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse PKN1 shRNA Plasmid |
20-abx983453 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Porcine PKN1 ELISA Kit |
EPP0125 |
Abclonal |
96Tests |
EUR 521 |
Rat PKN1 ELISA Kit |
ERP0125 |
Abclonal |
96Tests |
EUR 521 |
Rabbit PKN1 ELISA Kit |
ERTP0125 |
Abclonal |
96Tests |
EUR 521 |
Mouse PKN1 ELISA Kit |
EMP0125 |
Abclonal |
96Tests |
EUR 521 |
Serine/Threonine-Protein Kinase N1 (PKN1) Antibody |
20-abx015170 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Serine/Threonine-Protein Kinase N1 (PKN1) Antibody |
abx224112-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Serine/Threonine-Protein Kinase N1 (PKN1) Antibody |
abx149738-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Serine/Threonine-Protein Kinase N1 (PKN1) Antibody |
20-abx327640 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Protein Kinase N1 (PKN1) Polyclonal Antibody (Human) |
4-PAA501Hu01 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2272.00
-
EUR 571.00
-
EUR 288.00
-
EUR 207.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PKN1 (Phe615~Phe874)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1) |
Guinea Pig PKN1 ELISA Kit |
EGP0125 |
Abclonal |
96Tests |
EUR 521 |
Pkn1 ORF Vector (Rat) (pORF) |
ORF073569 |
ABM |
1.0 ug DNA |
EUR 506 |
PKN1 ORF Vector (Human) (pORF) |
ORF007881 |
ABM |
1.0 ug DNA |
EUR 95 |
Pkn1 ORF Vector (Mouse) (pORF) |
ORF054151 |
ABM |
1.0 ug DNA |
EUR 506 |
Pkn1 ORF Vector (Mouse) (pORF) |
ORF054152 |
ABM |
1.0 ug DNA |
EUR 506 |
The influenza A virus (IAV) matrix-2 (M2) protein is an antigenically conserved viral envelope protein that performs an needed place in virus budding together with one different envelope protein, hemagglutinin (HA). An M2-specific mouse monoclonal IgG antibody, rM2ss23, which binds to the ectodomain of the M2 protein, has been confirmed to be a non-neutralizing antibody, nevertheless inhibits plaque formation of IAV strains.
EBNA1 Binding Protein 2 (EBNA1BP2) Antibody
|
On this look at, we generated chimeric rM2ss23 (ch-rM2ss23) IgG and IgA antibodies with the similar variable space and in distinction their antiviral actions. Using gel chromatography, ch-rM2ss23 IgA have been divided into three antibody subsets: monomeric IgA (m-IgA), dimeric IgA (d-IgA), and trimeric and tetrameric IgA (t/q-IgA). We found that t/q-IgA had a significantly better functionality to chop again the plaque measurement of IAVs than IgG and m-IgA, virtually actually on account of decreased number of progeny virus particles produced from contaminated cells. Apparently, HA-M2 colocalization was remarkably decreased on the contaminated cell ground throughout the presence of ch-rM2ss23 antibodies.
These outcomes level out that anti-M2 polymeric IgA restricts IAV budding additional successfully than IgG and advocate a job of anti-M2 IgA in cross-protective immunity to IAVs.
-
Children with Coronavirus Sickness 2019 (COVID-19) have been reported to point milder indicators and better prognosis than their grownup counterparts, nevertheless the excellence of immune response in the direction of SARS-CoV-2 between children and adults hasn’t been reported.Attributable to this truth we initiated this look at to work out the choices of immune response in children with COVID-19. Sera and full blood cells from 19 children with COVID-19 all through completely completely different phases after sickness onset have been collected.
- The cytokine concentrations, SARS-CoV-2 S-RBD or N-specific antibodies and T cell immune responses have been detected respectively. In children with COVID-19, solely three of 12 cytokines have been elevated in acute sera, along with interferon (IFN)-γ-induced protein 10 (IP10), interleukin (IL)-10 and IL-16. We seen an increase in T helper (Th)-2 cells and a suppression in regulatory T cells (Treg) in victims all through acute part, nevertheless no very important response was found throughout the IFN-γ-producing or tumor necrosis situation (TNF)-α-producing CD8+ T cells in victims.
- S-RBD and N IgM confirmed an early induction, whereas S-RBD and N IgG have been prominently induced later in convalescent part. Potent S-RBD IgA response was seen nevertheless N IgA seemed to be inconspicuous.
EBV EBNA1 antibody |
20-EG46 |
Fitzgerald |
1 mg |
EUR 116 |
Description: Goat polyclonal EBV EBNA1 antibody |
Recombinant EBV EBNA1 Protein, His, E.coli-100ug |
QP11731-100ug |
EnQuireBio |
100ug |
EUR 318 |
Recombinant EBV EBNA1 Protein, His, E.coli-1mg |
QP11731-1mg |
EnQuireBio |
1mg |
EUR 1561 |
Recombinant EBV EBNA1 Protein, His, E.coli-500ug |
QP11731-500ug |
EnQuireBio |
500ug |
EUR 862 |
Recombinant EBV EBNA1 Mosaic Protein, His, E.coli-100ug |
QP11732-100ug |
EnQuireBio |
100ug |
EUR 218 |
Recombinant EBV EBNA1 Mosaic Protein, His, E.coli-1mg |
QP11732-1mg |
EnQuireBio |
1mg |
EUR 1061 |
Recombinant EBV EBNA1 Mosaic Protein, His, E.coli-500ug |
QP11732-500ug |
EnQuireBio |
500ug |
EUR 663 |
EBNA1 protein |
30-1925 |
Fitzgerald |
500 ug |
EUR 565 |
Description: Purified Recombinant EBNA1 protein |
Recombinant EBV EBNA1 Mosaic Protein (aa 1-90 & 408-498) [His] |
VAng-2528Lsx-100g |
Creative Biolabs |
100 µg |
EUR 463 |
Description: EBV EBNA1 Mosaic protein, His tag at C-terminus, recombinant protein from E. coli. |
Recombinant EBV EBNA1 Mosaic Protein (aa 1-90 & 408-498) [His] |
VAng-2528Lsx-1mg |
Creative Biolabs |
1 mg |
EUR 2800 |
Description: EBV EBNA1 Mosaic protein, His tag at C-terminus, recombinant protein from E. coli. |
Recombinant EBV EBNA1 Mosaic Protein (aa 1-90 & 408-498) [His] |
VAng-2528Lsx-500g |
Creative Biolabs |
500 µg |
EUR 1700 |
Description: EBV EBNA1 Mosaic protein, His tag at C-terminus, recombinant protein from E. coli. |
Recombinant EBV EBNA1 Mosaic Protein (aa 1-90 & 408-498) [GST] |
VAng-Lsx0111-100g |
Creative Biolabs |
100 µg |
EUR 633 |
Description: EBV EBNA1 Mosaic protein [GST], recombinant protein from E. coli. |
Recombinant EBV EBNA1 Mosaic Protein (aa 1-90 & 408-498) [GST] |
VAng-Lsx0111-500g |
Creative Biolabs |
500 µg |
EUR 2016 |
Description: EBV EBNA1 Mosaic protein [GST], recombinant protein from E. coli. |
Recombinant (E.Coli, GST tag) Epstein-Barr Virus (EBV/HHV-4) Mosaic EBNA1 |
RP-347 |
Alpha Diagnostics |
100 ug |
EUR 286 |
EBNA1 protein (His tag) |
80-1340 |
Fitzgerald |
100 ug |
EUR 241 |
Description: Purified recombinant EBNA1 protein (His tag) |
Recombinant EBNA1 Protein [GST] |
VAng-Lsx0122-100g |
Creative Biolabs |
100 µg |
EUR 682 |
Description: EBNA1 (EBV) (P03211) partial recombinant protein with GST tag expressed in E. coli. |
EBV protein |
30-1275 |
Fitzgerald |
1 mg |
EUR 3481 |
Description: Purified recombinant EBV protein |
EBV protein |
30-1276 |
Fitzgerald |
1 mg |
EUR 3481 |
Description: Purified recombinant EBV protein |
EBV Protein |
abx069822-1ml |
Abbexa |
1 ml |
EUR 690 |
- Shipped within 5-10 working days.
|
EBV Protein |
abx069824-1mg |
Abbexa |
1 mg |
EUR 1469 |
- Shipped within 5-10 working days.
|
EBV Protein |
abx069825-1ml |
Abbexa |
1 ml |
EUR 314 |
- Shipped within 5-10 working days.
|
EBV Protein |
abx069828-1mg |
Abbexa |
1 mg |
EUR 1817 |
- Shipped within 5-10 working days.
|
EBV Protein |
abx069829-1mg |
Abbexa |
1 mg |
EUR 1776 |
- Shipped within 5-10 working days.
|
EBNA1 Binding Protein 2 Protein |
20-abx260778 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
EBV EA protein |
30R-AE005 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Purified recombinant EBV EA protein |
EBV p18 protein |
30R-AE007 |
Fitzgerald |
500 ug |
EUR 806 |
Description: Purified recombinant EBV p18 protein |
EBV p23 protein |
30R-AE008 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Purified recombinant EBV p23 protein |
EBV EA protein |
30-1280 |
Fitzgerald |
1 mg |
EUR 3481 |
Description: Purified recombinant EBV EA protein |
EBV VCA protein |
30-1811 |
Fitzgerald |
1 ml |
EUR 381 |
Description: Purified native EBV VCA gp125 protein |
EBV EA protein |
30-1920 |
Fitzgerald |
1 ml |
EUR 414 |
Description: Viral lysate containing a high concentration of EBV antigens, including VCA, EBNA, EA-D and EA-R |
EBV EBNA protein |
30-AE46 |
Fitzgerald |
200 ug |
EUR 750 |
Description: Purified recombinant EBV EBNA protein |
EBV EA protein |
30-AE50 |
Fitzgerald |
200 ug |
EUR 813 |
Description: Purified recombinant EBV EA protein |
Recombinant EBV Protein |
VAng-Lsx0108-inquire |
Creative Biolabs |
inquire |
Ask for price |
Description: EBV, recombinant protein from human cells. |
EBNA1 (GFP-Puro) Lentivirus |
LVP1134-GP |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 349 |
Description: Premade lentivirus expressing Epstein Barr Virus' EBNA1 gene under EF1a promoter, containing GFP-Puromycin dual marker. |
EBNA1 (RFP-Bsd) Lentivirus |
LVP1134-RB |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 349 |
Description: Premade lentivirus expressing Epstein Barr Virus' EBNA1 gene under EF1a promoter, containing RFP-Blasticidin dual marker. |
EBNA1 Binding Protein 2 (EBNA1BP2) Antibody |
abx026949-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
EBNA1 Binding Protein 2 (EBNA1BP2) Antibody |
abx026949-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
EBNA1 Binding Protein 2 (EBNA1BP2) Antibody |
20-abx123650 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
EBV antibody |
10-E40C |
Fitzgerald |
200 ug |
EUR 229 |
Description: Mouse monoclonal EBV antibody |
EBV antibody |
10-E40D |
Fitzgerald |
200 ug |
EUR 136 |
Description: Mouse monoclonal EBV antibody |
EBV antibody |
10-E40E |
Fitzgerald |
200 ug |
EUR 212 |
Description: Mouse monoclonal EBV antibody |
EBV Virus |
G229 |
ABM |
10 ml |
EUR 735 |
EBV VCA p23 Protein |
abx069823-1mg |
Abbexa |
1 mg |
EUR 1497 |
- Shipped within 5-10 working days.
|
Recombinant EBV Protein [His] |
VAng-Lsx0112-inquire |
Creative Biolabs |
inquire |
Ask for price |
Description: EBV [His], recombinant protein from E. coli. |
Recombinant EBV P125 Protein |
VAng-Lsx0119-1mL |
Creative Biolabs |
1 mL |
EUR 388 |
Description: EBV P125 Protein, recombinant protein from E. coli. |
Recombinant EBV P125 Protein |
VAng-Lsx0119-25mL |
Creative Biolabs |
25 mL |
EUR 6099 |
Description: EBV P125 Protein, recombinant protein from E. coli. |
Epstein-Barr Virus (HHV-4) EBNA1 Protein |
20-abx260340 |
Abbexa |
-
EUR 1121.00
-
EUR 467.00
-
EUR 1970.00
|
|
- Shipped within 5-10 working days.
|
Recombinant EBNA1 Protein [His] (1.185 mg/mL) |
VAng-0610Lsx-inquire |
Creative Biolabs |
inquire |
Ask for price |
Description: Epstein-Barr Virus (EBV) Nuclear Antigen-1 (EBNA-1), recombinant protein from E. coli. MW 63 kDa, 1.185 mg/mL. |
Recombinant EBNA1 Protein [His] (1.25 mg/mL) |
VAng-0611Lsx-inquire |
Creative Biolabs |
inquire |
Ask for price |
Description: Epstein-Barr Virus (EBV) Nuclear Antigen-1 (EBNA-1), recombinant protein from E. coli. MW 63 kDa, 1.25 mg/mL. |
EBNA1BP2 EBNA1 Binding Protein 2 Human Recombinant Protein |
PROTQ99848 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: Recombinant Human EBNA1BP2 produced in E. coli is a single polypeptide chain containing 329 amino acids (1-306) and having a molecular mass of 37.2kDa.;EBNA1BP2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
EBV p18 protein (His tag) |
80-1355S |
Fitzgerald |
100 ug |
EUR 241 |
Description: Purified recombinant EBV p18 protein (His tag) |
EBV p54 protein (His tag) |
80-1361 |
Fitzgerald |
1 mg |
EUR 1083 |
Description: Purified recombinant EBV p54 protein (His tag) |
EBV p138 protein (His tag) |
80-1362 |
Fitzgerald |
1 mg |
EUR 1083 |
Description: Purified recombinant EBV p138 protein (His tag) |
EBV HHV-4 p23 Protein |
abx060518-1mg |
Abbexa |
1 mg |
EUR 1887 |
- Shipped within 5-10 working days.
|
EBV p54 (EA-D) Protein |
abx061433-1mg |
Abbexa |
1 mg |
EUR 1511 |
- Shipped within 5-10 working days.
|
Recombinant EBV P138 Protein [His] |
VAng-0612Lsx-inquire |
Creative Biolabs |
inquire |
Ask for price |
Description: EBV p138 Early Antigen D (EA-D) Protein, recombinant protein from E. coli. 1.00 mg/mL. |
Recombinant EBV P54 Protein [His] |
VAng-0613Lsx-inquire |
Creative Biolabs |
inquire |
Ask for price |
Description: EBV p54 Early Antigen D (EA-D) Protein, recombinant protein from E. coli. 1.068 mg/mL. |
Recombinant EBV P18 Protein [His] |
VAng-0614Lsx-inquire |
Creative Biolabs |
inquire |
Ask for price |
Description: EBV Viral Capsid Antigen (VCA) p18, recombinant protein from E. coli. 2.14 mg/mL. |
Recombinant EBV p23 Protein [GST] |
VAng-0617Lsx-inquire |
Creative Biolabs |
inquire |
Ask for price |
Description: EBV p23, recombinant protein from E. coli. 1.00 mg/mL. |
Inactivated EBV gp125 VCA Protein |
VAng-Lsx04574-1mL |
Creative Biolabs |
1 mL |
EUR 353 |
Description: Epstein-Barr Virus (Strain P3HR1) gp125 VCA, inactivated antigen. |
Inactivated EBV gp125 VCA Protein |
VAng-Lsx04574-25mL |
Creative Biolabs |
25 mL |
EUR 6099 |
Description: Epstein-Barr Virus (Strain P3HR1) gp125 VCA, inactivated antigen. |
Recombinant EBV P18 Mosaic Protein |
VAng-Lsx0115-inquire |
Creative Biolabs |
inquire |
Ask for price |
Description: EBV P18 Mosaic protein, recombinant protein from E. coli. |
Recombinant EBV P23 Protein [His] |
VAng-Lsx0117-inquire |
Creative Biolabs |
inquire |
Ask for price |
Description: Recombinant EBV p23 protein was expressed in E. coli and purified by proprietary chromatographic technique, 17.7kDa. |
Recombinant EBV BFRF3 Protein [GST] |
VAng-Lsx0120-inquire |
Creative Biolabs |
inquire |
Ask for price |
Description: BFRF3 (EBV) (P14348) partial recombinant protein with GST tag expressed in E. coli. |
Recombinant EBV BMRF1 Protein [GST] |
VAng-Lsx0121-inquire |
Creative Biolabs |
inquire |
Ask for price |
Description: BMRF1 (EBV) (P03191) partial recombinant protein with GST tag expressed in E. coli. |
EBV antibody (VCA) |
10-E40B |
Fitzgerald |
200 ug |
EUR 229 |
Description: Mouse monoclonal EBV antibody (VCA) |
EBV LMP2A Antibody |
abx021712-025mg |
Abbexa |
0.25 mg |
EUR 1010 |
- Shipped within 5-10 working days.
|
Inactivated EBV Antigen |
VAng-Lsx0109-1mL |
Creative Biolabs |
1 mL |
EUR 1360 |
Description: EBV, natural antigen. |
Epstein-Barr Virus (HHV-4) Mosaic EBNA1 Protein |
20-abx260113 |
Abbexa |
-
EUR 885.00
-
EUR 342.00
-
EUR 1372.00
|
|
- Shipped within 5-10 working days.
|
Human EBNA1 Binding Protein 2 (EBNA1BP2) ELISA Kit |
abx384822-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse EBNA1 Binding Protein 2 (EBNA1BP2) ELISA Kit |
abx389130-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
HHV-4 recombinant mosaic EBNA1 antigen |
00212-V-01mg |
Virogen |
0,1 mg |
EUR 267.5 |
- Category: Antigens, Epstein-Barr Virus, Ag
|
Description: HHV-4 recombinant mosaic EBNA1 antigen. Region: 1-90/408-498aa |