stat-2

 

Excessive decision two-dimensional electrophoresis of proteins

 

 

A way has been developed for the separation of proteins by two-dimensional polyacrylamide gel electrophoresis. Attributable to its decision and sensitivity, this method is a strong software for the evaluation and detection of proteins from advanced organic sources.

Proteins are separated in response to isoelectric level by isoelectric focusing within the first dimension, and in response to molecular weight by sodium dodecyl sulfate electrophoresis within the second dimension. Since these two parameters are unrelated, it’s potential to acquire an virtually uniform distribution of protein spots throughout a two-diminsional gel.

Serine/Threonine-Protein Kinase N1 (PKN1) Antibody

This system has resolved 1100 completely different elements from Escherichia coli and needs to be able to resolving a most of 5000 proteins. A protein containing as little as one disintegration per min of both 14C or 35S might be detected by autoradiography.

A protein which constitutes 10 minus four to 10 minus 5% of the entire protein might be detected and quantified by autoradiography. The reproducibility of the separation is enough to allow every spot on one separation to be matched with a spot on a special separation.

This system offers a technique for estimation (on the described sensitivities) of the variety of proteins made by any organic system. This method can resolve proteins differing in a single cost and consequently can be utilized within the evaluation of in vivo modifications leading to a change in cost. Proteins whose cost is modified by missense mutations might be recognized. An in depth description of the strategies in addition to the traits of this method are offered.

 

 

stat-2

stat-2

 

Recombinant EBV EBNA1 Protein, His, E.coli-100ug

 


Recurrent urinary tract infections (rUTI)
are a crucial sickness associated to morbidities and mortality. Resistance to the same old of care antibiotics is now widespread as a result of continued use of antibiotics amongst people who endure from rUTI.

  • We’re subsequently making a vaccine to forestall recurrences amongst victims with rUTI. The antigen of the vaccine is FimH, a bacterial adhesin protein, and the vaccine is adjuvanted with a TLR-4 agonist.
  • In a Part 1 scientific look at evaluating the vaccine, immunized individuals produced FimH-binding antibodies. Proper right here we describe the optimization, qualification, and use of an assay to judge the efficiency of these anti-FimH antibodies.
  • The suitability of the assay for its supposed perform was demonstrated by selectivity, specificity, sensitivity, and intra-assay and inter-assay precision.
  • The acceptance requirements have been achieved for all parameters along with intra-assay precision with ≤10% relative regular deviations and inter-assay precision with ≤25% relative regular deviations. The outcomes provided herein advocate this handy assay will most likely be needed for supporting the vaccine’s efficacy in future human analysis.
  • Furthermore and of good significance, these outcomes present that vaccine-induced helpful antibodies could also be elicited in rUTI victims in the direction of an important virulence situation, FimH.

 

Anti-PKN1 antibody
STJ190147 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PKN1
anti-PKN1
YF-PA13997 50 ug
EUR 363
Description: Mouse polyclonal to PKN1
anti-PKN1
YF-PA13998 100 ug
EUR 403
Description: Rabbit polyclonal to PKN1
anti-PKN1
YF-PA27338 100 ul
EUR 403
Description: Rabbit polyclonal to PKN1
Human Protein Kinase N1 (PKN1) ELISA Kit
DLR-PKN1-Hu-48T 48T
EUR 479
  • Should the Human Protein Kinase N1 (PKN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Kinase N1 (PKN1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Protein Kinase N1 (PKN1) ELISA Kit
DLR-PKN1-Hu-96T 96T
EUR 621
  • Should the Human Protein Kinase N1 (PKN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Kinase N1 (PKN1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Protein Kinase N1 (PKN1) ELISA Kit
RDR-PKN1-Hu-48Tests 48 Tests
EUR 500
Human Protein Kinase N1 (PKN1) ELISA Kit
RDR-PKN1-Hu-96Tests 96 Tests
EUR 692
Human Protein Kinase N1 (PKN1) ELISA Kit
RD-PKN1-Hu-48Tests 48 Tests
EUR 478
Human Protein Kinase N1 (PKN1) ELISA Kit
RD-PKN1-Hu-96Tests 96 Tests
EUR 662
Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349
Anti-PKN1 (1B10)
YF-MA14890 100 ug
EUR 363
Description: Mouse monoclonal to PKN1
Anti-PKN1 (1A4)
YF-MA14891 100 ug
EUR 363
Description: Mouse monoclonal to PKN1
PKN1 Antibody
48392-100ul 100ul
EUR 333
PKN1 Antibody
48392-50ul 50ul
EUR 239
PKN1 Antibody
DF4790 200ul
EUR 304
Description: PKN1 Antibody detects endogenous levels of total PKN1.
PKN1 Antibody
1-CSB-PA030259
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PKN1. Recognizes PKN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
PKN1 antibody
70R-50256 100 ul
EUR 244
Description: Purified Polyclonal PKN1 antibody
PKN1 Antibody
ABD4790 100 ug
EUR 438
PKN1/PRK1 Antibody
35295-100ul 100ul
EUR 252
PKN1/PRK1 Antibody
35295-50ul 50ul
EUR 187
PKN1 Conjugated Antibody
C48392 100ul
EUR 397
PKN1 Polyclonal Antibody
ABP59926-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
  • Applications tips:
Description: A polyclonal antibody for detection of PKN1 from Human, Mouse, Rat. This PKN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
PKN1 Polyclonal Antibody
ABP59926-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
  • Applications tips:
Description: A polyclonal antibody for detection of PKN1 from Human, Mouse, Rat. This PKN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
PKN1 Polyclonal Antibody
ABP59926-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
  • Applications tips:
Description: A polyclonal antibody for detection of PKN1 from Human, Mouse, Rat. This PKN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
PKN1 Polyclonal Antibody
ES8989-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PKN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
PKN1 Polyclonal Antibody
ES8989-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PKN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
Pkn1/ Rat Pkn1 ELISA Kit
ELI-37289r 96 Tests
EUR 886
PKN1 siRNA
20-abx904045
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PKN1 siRNA
20-abx928745
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PKN1 siRNA
20-abx928746
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PKN1/PRK1 Conjugated Antibody
C35295 100ul
EUR 397
Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280
Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280
Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280
PKN1 Rabbit pAb
A0553-100ul 100 ul
EUR 308
PKN1 Rabbit pAb
A0553-200ul 200 ul
EUR 459
PKN1 Rabbit pAb
A0553-20ul 20 ul
EUR 183
PKN1 Rabbit pAb
A0553-50ul 50 ul
EUR 223
PKN1 Blocking Peptide
DF4790-BP 1mg
EUR 195
PKN1 Blocking Peptide
20-abx063131
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
PKN1 cloning plasmid
CSB-CL623082HU-10ug 10ug
EUR 902
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2829
  • Sequence: atggccagcgacgccgtgcagagtgagcctcgcagctggtccctgctagagcagctgggcctggccggggcagacctggcggcccccggggtacagcagcagctggagctggagcgggagcggctgcggcgggaaatccgcaaggagctgaagctgaaggagggtgctgagaacc
  • Show more
Description: A cloning plasmid for the PKN1 gene.
Protein Kinase N1 (PKN1) Antibody
20-abx008827
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Protein Kinase N1 (PKN1) Antibody
20-abx101658
  • EUR 300.00
  • EUR 133.00
  • EUR 746.00
  • EUR 398.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Protein Kinase N1 (PKN1) Antibody
20-abx135704
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protein Kinase N1 (PKN1) Antibody
20-abx174267
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.
Monoclonal PKN1 Antibody, Clone: EPR3238
AMM07214G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human PKN1. The antibodies are raised in Rabbit and are from clone EPR3238. This antibody is applicable in WB, FC
Monoclonal PKN1 Antibody, Clone: 4H10B1
AMM03009G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human PKN1. The antibodies are raised in Mouse and are from clone 4H10B1. This antibody is applicable in WB and IHC, FC, ICC, E
Antibody for Human PKN1 (pThr774)
SPC-1065D 0.1ml
EUR 354
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is unconjugated.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A390 0.1ml
EUR 401
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 390.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A488 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 488.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A565 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 565.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A594 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 594.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A633 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 633.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A655 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 655.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A680 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 680.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A700 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 700.
Antibody for Human PKN1 (pThr774)
SPC-1065D-ALP 0.1ml
EUR 394
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Alkaline Phosphatase.
Antibody for Human PKN1 (pThr774)
SPC-1065D-APC 0.1ml
EUR 399
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to APC .
Antibody for Human PKN1 (pThr774)
SPC-1065D-APCCY7 0.1ml
EUR 471
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to APC/Cy7.
Antibody for Human PKN1 (pThr774)
SPC-1065D-BI 0.1ml
EUR 396
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Biotin.
Antibody for Human PKN1 (pThr774)
SPC-1065D-DY350 0.1ml
EUR 475
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 350.
Antibody for Human PKN1 (pThr774)
SPC-1065D-DY405 0.1ml
EUR 452
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 405.
Antibody for Human PKN1 (pThr774)
SPC-1065D-DY488 0.1ml
EUR 432
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 488.
Antibody for Human PKN1 (pThr774)
SPC-1065D-DY594 0.1ml
EUR 436
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 594.
Antibody for Human PKN1 (pThr774)
SPC-1065D-DY633 0.1ml
EUR 426
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 633.
Antibody for Human PKN1 (pThr774)
SPC-1065D-FITC 0.1ml
EUR 392
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to FITC.
Antibody for Human PKN1 (pThr774)
SPC-1065D-HRP 0.1ml
EUR 388
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to HRP.
Antibody for Human PKN1 (pThr774)
SPC-1065D-P594 0.1ml
EUR 407
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to PE/ATTO 594.
Antibody for Human PKN1 (pThr774)
SPC-1065D-PCP 0.1ml
EUR 399
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to PerCP.
Antibody for Human PKN1 (pThr774)
SPC-1065D-RPE 0.1ml
EUR 397
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to RPE .
Antibody for Human PKN1 (pThr774)
SPC-1065D-STR 0.1ml
EUR 398
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Streptavidin.
Human PKN1 ELISA Kit
EHP0125 96Tests
EUR 521
Bovine PKN1 ELISA Kit
EBP0125 96Tests
EUR 521
Anserini PKN1 ELISA Kit
EAP0125 96Tests
EUR 521
Canine PKN1 ELISA Kit
ECP0125 96Tests
EUR 521
Goat PKN1 ELISA Kit
EGTP0125 96Tests
EUR 521
PKN1 ELISA KIT|Human
EF005461 96 Tests
EUR 689
Rat PKN1 shRNA Plasmid
20-abx985442
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human PKN1 shRNA Plasmid
20-abx953755
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse PKN1 shRNA Plasmid
20-abx983453
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Porcine PKN1 ELISA Kit
EPP0125 96Tests
EUR 521
Rat PKN1 ELISA Kit
ERP0125 96Tests
EUR 521
Rabbit PKN1 ELISA Kit
ERTP0125 96Tests
EUR 521
Mouse PKN1 ELISA Kit
EMP0125 96Tests
EUR 521
Serine/Threonine-Protein Kinase N1 (PKN1) Antibody
20-abx015170
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Serine/Threonine-Protein Kinase N1 (PKN1) Antibody
abx224112-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
Serine/Threonine-Protein Kinase N1 (PKN1) Antibody
abx149738-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Serine/Threonine-Protein Kinase N1 (PKN1) Antibody
20-abx327640
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Protein Kinase N1 (PKN1) Polyclonal Antibody (Human)
4-PAA501Hu01
  • EUR 232.00
  • EUR 2272.00
  • EUR 571.00
  • EUR 288.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1)
Guinea Pig PKN1 ELISA Kit
EGP0125 96Tests
EUR 521
Pkn1 ORF Vector (Rat) (pORF)
ORF073569 1.0 ug DNA
EUR 506
PKN1 ORF Vector (Human) (pORF)
ORF007881 1.0 ug DNA
EUR 95
Pkn1 ORF Vector (Mouse) (pORF)
ORF054151 1.0 ug DNA
EUR 506
Pkn1 ORF Vector (Mouse) (pORF)
ORF054152 1.0 ug DNA
EUR 506

The influenza A virus (IAV) matrix-2 (M2) protein is an antigenically conserved viral envelope protein that performs an needed place in virus budding together with one different envelope protein, hemagglutinin (HA). An M2-specific mouse monoclonal IgG antibody, rM2ss23, which binds to the ectodomain of the M2 protein, has been confirmed to be a non-neutralizing antibody, nevertheless inhibits plaque formation of IAV strains.

EBNA1 Binding Protein 2 (EBNA1BP2) Antibody

 

 

On this look at, we generated chimeric rM2ss23 (ch-rM2ss23) IgG and IgA antibodies with the similar variable space and in distinction their antiviral actions. Using gel chromatography, ch-rM2ss23 IgA have been divided into three antibody subsets: monomeric IgA (m-IgA), dimeric IgA (d-IgA), and trimeric and tetrameric IgA (t/q-IgA). We found that t/q-IgA had a significantly better functionality to chop again the plaque measurement of IAVs than IgG and m-IgA, virtually actually on account of decreased number of progeny virus particles produced from contaminated cells. Apparently, HA-M2 colocalization was remarkably decreased on the contaminated cell ground throughout the presence of ch-rM2ss23 antibodies.

These outcomes level out that anti-M2 polymeric IgA restricts IAV budding additional successfully than IgG and advocate a job of anti-M2 IgA in cross-protective immunity to IAVs.

 

 

 

  • Children with Coronavirus Sickness 2019 (COVID-19) have been reported to point milder indicators and better prognosis than their grownup counterparts, nevertheless the excellence of immune response in the direction of SARS-CoV-2 between children and adults hasn’t been reported.Attributable to this truth we initiated this look at to work out the choices of immune response in children with COVID-19. Sera and full blood cells from 19 children with COVID-19 all through completely completely different phases after sickness onset have been collected.
  • The cytokine concentrations, SARS-CoV-2 S-RBD or N-specific antibodies and T cell immune responses have been detected respectively. In children with COVID-19, solely three of 12 cytokines have been elevated in acute sera, along with interferon (IFN)-γ-induced protein 10 (IP10), interleukin (IL)-10 and IL-16. We seen an increase in T helper (Th)-2 cells and a suppression in regulatory T cells (Treg) in victims all through acute part, nevertheless no very important response was found throughout the IFN-γ-producing or tumor necrosis situation (TNF)-α-producing CD8T cells in victims.
  • S-RBD and N IgM confirmed an early induction, whereas S-RBD and N IgG have been prominently induced later in convalescent part. Potent S-RBD IgA response was seen nevertheless N IgA seemed to be inconspicuous.

 

 

EBV EBNA1 antibody

20-EG46 1 mg
EUR 116
Description: Goat polyclonal EBV EBNA1 antibody

EBV EBNA1 [GST]

DAG1850 500 ug
EUR 2529

EBV Mosaic EBNA1 protein [GST]

DAG1577 100 µg
EUR 645

Anti-EBV-EBNA1 antibody

STJ16101052 100 µg
EUR 354

Recombinant EBV EBNA1 Protein, His, E.coli-100ug

QP11731-100ug 100ug
EUR 318

Recombinant EBV EBNA1 Protein, His, E.coli-1mg

QP11731-1mg 1mg
EUR 1561

Recombinant EBV EBNA1 Protein, His, E.coli-500ug

QP11731-500ug 500ug
EUR 862

Recombinant EBV EBNA1 Mosaic Protein, His, E.coli-100ug

QP11732-100ug 100ug
EUR 218

Recombinant EBV EBNA1 Mosaic Protein, His, E.coli-1mg

QP11732-1mg 1mg
EUR 1061

Recombinant EBV EBNA1 Mosaic Protein, His, E.coli-500ug

QP11732-500ug 500ug
EUR 663

EBNA1 protein

30-1925 500 ug
EUR 565
Description: Purified Recombinant EBNA1 protein

Recombinant EBV EBNA1 Mosaic Protein (aa 1-90 & 408-498) [His]

VAng-2528Lsx-100g 100 µg
EUR 463
Description: EBV EBNA1 Mosaic protein, His tag at C-terminus, recombinant protein from E. coli.

Recombinant EBV EBNA1 Mosaic Protein (aa 1-90 & 408-498) [His]

VAng-2528Lsx-1mg 1 mg
EUR 2800
Description: EBV EBNA1 Mosaic protein, His tag at C-terminus, recombinant protein from E. coli.

Recombinant EBV EBNA1 Mosaic Protein (aa 1-90 & 408-498) [His]

VAng-2528Lsx-500g 500 µg
EUR 1700
Description: EBV EBNA1 Mosaic protein, His tag at C-terminus, recombinant protein from E. coli.

Recombinant EBV EBNA1 Mosaic Protein (aa 1-90 & 408-498) [GST]

VAng-Lsx0111-100g 100 µg
EUR 633
Description: EBV EBNA1 Mosaic protein [GST], recombinant protein from E. coli.

Recombinant EBV EBNA1 Mosaic Protein (aa 1-90 & 408-498) [GST]

VAng-Lsx0111-500g 500 µg
EUR 2016
Description: EBV EBNA1 Mosaic protein [GST], recombinant protein from E. coli.

pCXWB- EBNA1

PVT10196 2 ug
EUR 301

Recombinant (E.Coli, GST tag) Epstein-Barr Virus (EBV/HHV-4) Mosaic EBNA1

RP-347 100 ug
EUR 286

EBNA1 protein (His tag)

80-1340 100 ug
EUR 241
Description: Purified recombinant EBNA1 protein (His tag)

Recombinant EBNA1 Protein [GST]

VAng-Lsx0122-100g 100 µg
EUR 682
Description: EBNA1 (EBV) (P03211) partial recombinant protein with GST tag expressed in E. coli.

EBV protein

30-1275 1 mg
EUR 3481
Description: Purified recombinant EBV protein

EBV protein

30-1276 1 mg
EUR 3481
Description: Purified recombinant EBV protein

EBV Protein

abx069822-1ml 1 ml
EUR 690
  • Shipped within 5-10 working days.

EBV Protein

abx069824-1mg 1 mg
EUR 1469
  • Shipped within 5-10 working days.

EBV Protein

abx069825-1ml 1 ml
EUR 314
  • Shipped within 5-10 working days.

EBV Protein

abx069828-1mg 1 mg
EUR 1817
  • Shipped within 5-10 working days.

EBV Protein

abx069829-1mg 1 mg
EUR 1776
  • Shipped within 5-10 working days.

EBNA1 Binding Protein 2 Protein

20-abx260778
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

pCXWB- EBNA1 Plasmid

PVT7175 2 ug
EUR 266

EBV EA protein

30R-AE005 100 ug
EUR 327
Description: Purified recombinant EBV EA protein

EBV p18 protein

30R-AE007 500 ug
EUR 806
Description: Purified recombinant EBV p18 protein

EBV p23 protein

30R-AE008 100 ug
EUR 327
Description: Purified recombinant EBV p23 protein

EBV EA protein

30-1280 1 mg
EUR 3481
Description: Purified recombinant EBV EA protein

EBV VCA protein

30-1811 1 ml
EUR 381
Description: Purified native EBV VCA gp125 protein

EBV EA protein

30-1920 1 ml
EUR 414
Description: Viral lysate containing a high concentration of EBV antigens, including VCA, EBNA, EA-D and EA-R

EBV EBNA protein

30-AE46 200 ug
EUR 750
Description: Purified recombinant EBV EBNA protein

EBV EA protein

30-AE50 200 ug
EUR 813
Description: Purified recombinant EBV EA protein

Recombinant EBV Protein

VAng-Lsx0108-inquire inquire Ask for price
Description: EBV, recombinant protein from human cells.

EBNA1 (GFP-Puro) Lentivirus

LVP1134-GP 1x107 IFU/ml x 200ul
EUR 349
Description: Premade lentivirus expressing Epstein Barr Virus' EBNA1 gene under EF1a promoter, containing GFP-Puromycin dual marker.

EBNA1 (RFP-Bsd) Lentivirus

LVP1134-RB 1x107 IFU/ml x 200ul
EUR 349
Description: Premade lentivirus expressing Epstein Barr Virus' EBNA1 gene under EF1a promoter, containing RFP-Blasticidin dual marker.

EBNA1 Binding Protein 2 (EBNA1BP2) Antibody

abx026949-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

EBNA1 Binding Protein 2 (EBNA1BP2) Antibody

abx026949-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

EBNA1 Binding Protein 2 (EBNA1BP2) Antibody

20-abx123650
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

EBV antibody

10-E40C 200 ug
EUR 229
Description: Mouse monoclonal EBV antibody

EBV antibody

10-E40D 200 ug
EUR 136
Description: Mouse monoclonal EBV antibody

EBV antibody

10-E40E 200 ug
EUR 212
Description: Mouse monoclonal EBV antibody

EBV [His]

DAG1578 100 µg
EUR 810

EBV [GST]

DAG1580 100 µg
EUR 645

EBV [GST]

DAG1581 100 µg
EUR 810

EBV [His]

DAG1584 100 µg
EUR 810

EBV Virus

G229 10 ml
EUR 735

EBV P18 Mosaic protein

DAG1582 100 µg
EUR 645

EBV VCA p23 Protein

abx069823-1mg 1 mg
EUR 1497
  • Shipped within 5-10 working days.

Recombinant EBV Protein [His]

VAng-Lsx0112-inquire inquire Ask for price
Description: EBV [His], recombinant protein from E. coli.

Recombinant EBV P125 Protein

VAng-Lsx0119-1mL 1 mL
EUR 388
Description: EBV P125 Protein, recombinant protein from E. coli.

Recombinant EBV P125 Protein

VAng-Lsx0119-25mL 25 mL
EUR 6099
Description: EBV P125 Protein, recombinant protein from E. coli.

Epstein-Barr Virus (HHV-4) EBNA1 Protein

20-abx260340
  • EUR 1121.00
  • EUR 467.00
  • EUR 1970.00
  • 0.5 mg
  • 100 ug
  • 1 mg
  • Shipped within 5-10 working days.

Recombinant EBNA1 Protein [His] (1.185 mg/mL)

VAng-0610Lsx-inquire inquire Ask for price
Description: Epstein-Barr Virus (EBV) Nuclear Antigen-1 (EBNA-1), recombinant protein from E. coli. MW 63 kDa, 1.185 mg/mL.

Recombinant EBNA1 Protein [His] (1.25 mg/mL)

VAng-0611Lsx-inquire inquire Ask for price
Description: Epstein-Barr Virus (EBV) Nuclear Antigen-1 (EBNA-1), recombinant protein from E. coli. MW 63 kDa, 1.25 mg/mL.

EBNA1BP2 EBNA1 Binding Protein 2 Human Recombinant Protein

PROTQ99848 Regular: 20ug
EUR 317
Description: Recombinant Human EBNA1BP2 produced in E. coli is a single polypeptide chain containing 329 amino acids (1-306) and having a molecular mass of 37.2kDa.;EBNA1BP2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

EBV p18 protein (His tag)

80-1355S 100 ug
EUR 241
Description: Purified recombinant EBV p18 protein (His tag)

EBV p54 protein (His tag)

80-1361 1 mg
EUR 1083
Description: Purified recombinant EBV p54 protein (His tag)

EBV p138 protein (His tag)

80-1362 1 mg
EUR 1083
Description: Purified recombinant EBV p138 protein (His tag)

EBV HHV-4 p23 Protein

abx060518-1mg 1 mg
EUR 1887
  • Shipped within 5-10 working days.

EBV p54 (EA-D) Protein

abx061433-1mg 1 mg
EUR 1511
  • Shipped within 5-10 working days.

Recombinant EBV P138 Protein [His]

VAng-0612Lsx-inquire inquire Ask for price
Description: EBV p138 Early Antigen D (EA-D) Protein, recombinant protein from E. coli. 1.00 mg/mL.

Recombinant EBV P54 Protein [His]

VAng-0613Lsx-inquire inquire Ask for price
Description: EBV p54 Early Antigen D (EA-D) Protein, recombinant protein from E. coli. 1.068 mg/mL.

Recombinant EBV P18 Protein [His]

VAng-0614Lsx-inquire inquire Ask for price
Description: EBV Viral Capsid Antigen (VCA) p18, recombinant protein from E. coli. 2.14 mg/mL.

Recombinant EBV p23 Protein [GST]

VAng-0617Lsx-inquire inquire Ask for price
Description: EBV p23, recombinant protein from E. coli. 1.00 mg/mL.

Inactivated EBV gp125 VCA Protein

VAng-Lsx04574-1mL 1 mL
EUR 353
Description: Epstein-Barr Virus (Strain P3HR1) gp125 VCA, inactivated antigen.

Inactivated EBV gp125 VCA Protein

VAng-Lsx04574-25mL 25 mL
EUR 6099
Description: Epstein-Barr Virus (Strain P3HR1) gp125 VCA, inactivated antigen.

Recombinant EBV P18 Mosaic Protein

VAng-Lsx0115-inquire inquire Ask for price
Description: EBV P18 Mosaic protein, recombinant protein from E. coli.

Recombinant EBV P23 Protein [His]

VAng-Lsx0117-inquire inquire Ask for price
Description: Recombinant EBV p23 protein was expressed in E. coli and purified by proprietary chromatographic technique, 17.7kDa.

Recombinant EBV BFRF3 Protein [GST]

VAng-Lsx0120-inquire inquire Ask for price
Description: BFRF3 (EBV) (P14348) partial recombinant protein with GST tag expressed in E. coli.

Recombinant EBV BMRF1 Protein [GST]

VAng-Lsx0121-inquire inquire Ask for price
Description: BMRF1 (EBV) (P03191) partial recombinant protein with GST tag expressed in E. coli.

EBV antibody (VCA)

10-E40B 200 ug
EUR 229
Description: Mouse monoclonal EBV antibody (VCA)

EBV BMRF1 [GST]

DAG1849 500 ug
EUR 2529

EBV Glycoprotein 125

DAG3085 25 ml
EUR 1639

Recombinant EBV p18

DAGA-3074 100ug
EUR 1066

EBV LMP2A Antibody

abx021712-025mg 0.25 mg
EUR 1010
  • Shipped within 5-10 working days.

Inactivated EBV Antigen

VAng-Lsx0109-1mL 1 mL
EUR 1360
Description: EBV, natural antigen.

Epstein-Barr Virus (HHV-4) Mosaic EBNA1 Protein

20-abx260113
  • EUR 885.00
  • EUR 342.00
  • EUR 1372.00
  • 0.5 mg
  • 100 ug
  • 1 mg
  • Shipped within 5-10 working days.

Human EBNA1 Binding Protein 2 (EBNA1BP2) ELISA Kit

abx384822-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse EBNA1 Binding Protein 2 (EBNA1BP2) ELISA Kit

abx389130-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

HHV-4 recombinant mosaic EBNA1 antigen

00212-V-01mg 0,1 mg
EUR 267.5
  • Category: Antigens, Epstein-Barr Virus, Ag
Description: HHV-4 recombinant mosaic EBNA1 antigen. Region: 1-90/408-498aa