stat-2

Human Recombinant Protein Interleukin

 

 

Fabrication of Vascularized Bone Flaps with Sustained Launch of Recombinant Human Bone Morphogenetic Protein-2 and Arteriovenous Bundle.

 

  • It’s a frequent therapy technique within the clinic to transplant a vascularized bone flap for a big bone defect. But it surely is tough for peripheral blood vessels to develop into the central area of a big bone assemble.
  • On this examine, we fabricated a vascularized bone flap from a three-dimensional (3D)-printed biodegradable poly(lactide-co-glycolide) (PLGA)/β-tri-calcium phosphate (β-TCP) scaffold utilizing the mix of an arteriovenous (AV) bundle and recombinant human bone morphogenetic protein-2 (rhBMP-2).
  • A degradable porous PLGA/β-TCP scaffold was ready by adopting 3D plotting and a low-temperature deposition approach. rhBMP-2 chitosan microspheres (CMs) have been fabricated and loaded into the scaffolds to induce ectopic bone formation.
  • In Group SBV (scaffold+rhBMP-2+vessel), a femoral AV bundle was implanted into the central tunnel of the composite earlier than embedding into intramuscular pockets. In Group SB (scaffold+rhBMP-2), the composite was immediately implanted into intramuscular pockets.
  • Bone formation was evaluated by imaging evaluation (X-rays and microcomputed tomography) and histological evaluation (Hematoxylin and Eosin staining and Masson staining) after four and 12 weeks, respectively.
  • Vascularization was additionally assessed by imaging evaluation (Microfil angiography) and histological evaluation (CD31 immunohistochemical staining). The 3D-printed PLGA/β-TCP scaffold had good cytocompatibility.
  • Ectopic bone formation within the scaffold might be efficiently induced by the managed launch of rhBMP-2 by CMs. Evaluating teams SBV and SB, vascularization of the composite was considerably enhanced by AV bundle implantation at four and 12 weeks.

    stat-2

    stat-2

  • Furthermore, rhBMP-2-induced bone formation was additionally considerably improved by the AV bundle at four and 12 weeks.
  • The AV bundle not solely improved vascularization and bone formation of the assemble, but additionally offered an outlined vascular axis to attach with the vascular system of the bone defect by microsurgical methods.
  • It offered a brand new potential therapy technique to restore massive bone defects, particularly for these with low vascular provide.

 

Pseudo-Pedicle Heterotopic Ossification From Use of Recombinant Human Bone Morphogenetic Protein 2 (rhBMP-2) in Transforaminal Lumbar Interbody Fusion Cages.

We carried out a examine to find out the frequent traits of sufferers who developed radiculopathy signs and corresponding heterotopic ossification (HO) from transforaminal lumbar interbody fusions (TLIF) utilizing recombinant human bone morphogenetic protein 2 (rhBMP-2). HO can come up from a disk house with rhBMP-2 use in TLIF.

Formation of bone round nerve roots or the thecal sac could cause a radiculopathy with a constant sample of signs. We recognized 38 sufferers (26 males, 12 females) with a imply (SD) age of 50.8 (7.5) years who developed radiculopathy signs and corresponding HO from TLIF with rhBMP-2 within the disk house between 2002 and 2015.

To doc this complication and enhance its recognition, we recorded frequent patterns of symptom improvement and radiologic findings: particularly, time from implantation of rhBMP-2 to symptom improvement, consistency with aspect of TLIF placement, and radiologic findings. Radicular ache usually developed a imply (SD) of three.8 (1.0) months after TLIF with rhBMP-2.

Growth of radiculopathy signs corresponded to constant “pseudo-pedicle”-like HO. In all 38 sufferers, HO arising from the annulotomy web site confirmed a definite pseudo-pedicle sample encompassing nerve roots and the thecal sac. As well as, improvement of radiculopathy signs and corresponding HO seem like impartial of quantity of rhBMP-2.

HO ensuing from TLIF with rhBMP-2 within the disk house is a ache generator and a recognizable complication that may be recognized by evaluation of signs and computed tomography traits.

 

 

 

IL1F6 ORF Vector (Human) (pORF)

Heterozygous PAX6 gene mutations resulting in haploinsufficiency are the principle explanation for congenital aniridia, a uncommon and progressive panocular illness characterised by decreased visible acuity. As much as 90% of sufferers endure from aniridia-related keratopathy (ARK), attributable to a mixture of things together with limbal epithelial stem cell (LSC) deficiency, impaired therapeutic response and irregular differentiation of the corneal epithelium.

It often begins within the first decade of life, leading to recurrent corneal erosions, sub-epithelial fibrosis, and corneal opacification. Sadly, there are at the moment no environment friendly remedies obtainable for these sufferers and no in vitro mannequin for this pathology. We used CRISPR/Cas9 expertise to introduce into the PAX6 gene of LSCs a heterozygous nonsense mutation present in ARK sufferers.

9 clones carrying a p.E109X mutation on one allele have been obtained with no off-target mutations. In contrast with the parental LSCs, heterozygous mutant LSCs displayed decreased expression of PAX6 and marked slow-down of cell proliferation, migration and detachment.

 

IL1F6 Antibody
DF2524 200ul
EUR 304.00
Description: IL1F6 antibody detects endogenous levels of total IL1F6.
anti-IL1F6
YF-PA18405 50 ug
EUR 363.00
Description: Mouse polyclonal to IL1F6
IL1F6 Blocking Peptide
DF2524-BP 1mg
EUR 195.00
IL1F6 Conjugated Antibody
C44817 100ul
EUR 397.00
IL1F6 ORF Vector (Human) (pORF)
ORF013344 1.0 ug DNA
EUR 95.00
IL1F6 Protein Vector (Human) (pPB-C-His)
PV053373 500 ng
EUR 481.00
IL1F6 Protein Vector (Human) (pPB-N-His)
PV053374 500 ng
EUR 481.00
IL1F6 Protein Vector (Human) (pPM-C-HA)
PV053375 500 ng
EUR 481.00
IL1F6 Protein Vector (Human) (pPM-C-His)
PV053376 500 ng
EUR 481.00
IL1F6 sgRNA CRISPR Lentivector set (Human)
K1074101 3 x 1.0 ug
EUR 339.00
Recombinant Human IL1F6/ IL36 Protein, Untagged, E.coli-100ug
QP10330-ec-100ug 100ug
EUR 1995.00
Recombinant Human IL1F6/ IL36 Protein, Untagged, E.coli-10ug
QP10330-ec-10ug 10ug
EUR 290.00
Recombinant Human IL1F6/ IL36 Protein, Untagged, E.coli-250ug
QP10330-ec-250ug 250ug
EUR 3536.00
Recombinant Human IL1F6/ IL36 Protein, Untagged, E.coli-2ug
QP10330-ec-2ug 2ug
EUR 154.00
Recombinant Human IL1F6/ IL36 Protein, GST, E.coli-100ug
QP8208-ec-100ug 100ug
EUR 408.00
Recombinant Human IL1F6/ IL36 Protein, GST, E.coli-10ug
QP8208-ec-10ug 10ug
EUR 200.00
Recombinant Human IL1F6/ IL36 Protein, GST, E.coli-1mg
QP8208-ec-1mg 1mg
EUR 1632.00
Recombinant Human IL1F6/ IL36 Protein, GST, E.coli-200ug
QP8208-ec-200ug 200ug
EUR 634.00
Recombinant Human IL1F6/ IL36 Protein, GST, E.coli-500ug
QP8208-ec-500ug 500ug
EUR 1060.00
Recombinant Human IL1F6/ IL36 Protein, GST, E.coli-50ug
QP8208-ec-50ug 50ug
EUR 263.00
IL1F6 Protein Vector (Rat) (pPB-C-His)
PV274422 500 ng
EUR 603.00
IL1F6 Protein Vector (Rat) (pPB-N-His)
PV274423 500 ng
EUR 603.00
IL1F6 Protein Vector (Rat) (pPM-C-HA)
PV274424 500 ng
EUR 603.00
IL1F6 Protein Vector (Rat) (pPM-C-His)
PV274425 500 ng
EUR 603.00
IL1F6 Protein Vector (Mouse) (pPB-C-His)
PV191362 500 ng
EUR 603.00
IL1F6 Protein Vector (Mouse) (pPB-N-His)
PV191363 500 ng
EUR 603.00
IL1F6 Protein Vector (Mouse) (pPM-C-HA)
PV191364 500 ng
EUR 603.00
IL1F6 Protein Vector (Mouse) (pPM-C-His)
PV191365 500 ng
EUR 603.00
Il1f6 ORF Vector (Mouse) (pORF)
ORF047841 1.0 ug DNA
EUR 506.00
Il1f6 ORF Vector (Rat) (pORF)
ORF068606 1.0 ug DNA
EUR 506.00
Human Interleukin-36 alpha(IL1F6) ELISA kit
CSB-EL011617HU-24T 1 plate of 24 wells
EUR 165.00
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin-36 alpha (IL1F6) in samples from serum, plasma, tissue homogenates, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Interleukin-36 alpha(IL1F6) ELISA kit
1-CSB-EL011617HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin-36 alpha(IL1F6) in samples from serum, plasma, tissue homogenates, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
IL1F6 sgRNA CRISPR Lentivector (Human) (Target 1)
K1074102 1.0 ug DNA
EUR 154.00
IL1F6 sgRNA CRISPR Lentivector (Human) (Target 2)
K1074103 1.0 ug DNA
EUR 154.00
IL1F6 sgRNA CRISPR Lentivector (Human) (Target 3)
K1074104 1.0 ug DNA
EUR 154.00
Recombinant Mouse IL1F6/ IL36 Protein, Untagged, E.coli-100ug
QP10465-ec-100ug 100ug
EUR 1995.00
Recombinant Mouse IL1F6/ IL36 Protein, Untagged, E.coli-10ug
QP10465-ec-10ug 10ug
EUR 290.00
Recombinant Mouse IL1F6/ IL36 Protein, Untagged, E.coli-250ug
QP10465-ec-250ug 250ug
EUR 3536.00
Recombinant Mouse IL1F6/ IL36 Protein, Untagged, E.coli-2ug
QP10465-ec-2ug 2ug
EUR 154.00
Il1f6 sgRNA CRISPR Lentivector set (Mouse)
K3933201 3 x 1.0 ug
EUR 339.00
Il1f6 sgRNA CRISPR Lentivector set (Rat)
K6578501 3 x 1.0 ug
EUR 339.00
IL1F6 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV815007 1.0 ug DNA
EUR 450.00
IL1F6 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV815011 1.0 ug DNA
EUR 450.00
IL1F6 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV815012 1.0 ug DNA
EUR 450.00
Interleukin-1 Family Member 6 (IL1F6) Antibody
20-abx215373
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Human IL1F6/ IL36 Protein, Untagged, E.coli-100ug

 

Furthermore, addition to the tradition medium of recombinant PAX6 protein fused to a cell penetrating peptide was in a position to activate the endogenous PAX6 gene and to rescue phenotypic defects of mutant LSCs, suggesting that administration of such recombinant PAX6 protein might be a promising therapeutic strategy for aniridia-related keratopathy.

Extra usually, our outcomes exhibit that introduction of illness mutations into LSCs by CRISPR/Cas9 genome modifying permits the creation of related mobile fashions of ocular illness that ought to tremendously facilitate screening of novel therapeutic approaches. Stem Cells 2018;36:1421-1429.

 

Human Interleukin-36 alpha(IL1F6) ELISA package

Description: Quantitativesandwich ELISA package for measuring Human Interleukin-36 alpha (IL1F6) in samples from serum, plasma, tissue homogenates, cell tradition supernates.

A brand new trial model of the package, which lets you take a look at the package in your utility at an affordable worth.

 

 

 

UPK2 Uroplakin 2 Human Recombinant Protein

 

Description: UPK2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 153 amino acids (26-155 a.a) and having a molecular mass of 16.2kDa.;UPK2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic methods.

 

 

 

 

UPK2 Recombinant Protein (Mouse)
RP183206 100 ug Ask for price

UPK2 Uroplakin 2 Human Recombinant Protein
PROTO00526 Regular: 20ug
EUR 317.00
Description: UPK2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 153 amino acids (26-155 a.a) and having a molecular mass of 16.2kDa.;UPK2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Recombinant Human UPK2 Protein, His, E.coli-1mg
QP13897-1mg 1mg
EUR 2757.00

Recombinant Human UPK2 Protein, His, E.coli-20ug
QP13897-20ug 20ug
EUR 201.00

Recombinant Human UPK2 Protein, His, E.coli-5ug
QP13897-5ug 5ug
EUR 155.00

Recombinant Uroplakin 2 (UPK2)
4-RPF561Hu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O00526
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Uroplakin 2 expressed in: E.coli

Human Uroplakin 2 (UPK2) Protein
20-abx650668
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

UPK2 Antibody
1-CSB-PA025656GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UPK2. Recognizes UPK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

UPK2 antibody
70R-21174 50 ul
EUR 435.00
Description: Rabbit polyclonal UPK2 antibody

UPK2 siRNA
20-abx939075
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Uroplakin-2 (UPK2) Protein
20-abx261408
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

UPK2 protein (His tag)
30R-2967 100 ug
EUR 322.00
Description: Purified recombinant Human UPK2 protein (His tag)

Recombinant Human Uroplakin-2/UPK2 (C-6His)
CA11-10ug 10ug
EUR 202.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Uroplakin-2/UPK2 (C-6His)
CA11-1mg 1mg
EUR 2283.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Uroplakin-2/UPK2 (C-6His)
CA11-500ug 500ug
EUR 1613.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Uroplakin-2/UPK2 (C-6His)
CA11-50ug 50ug
EUR 496.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

UPK2 ELISA KIT|Human
EF004088 96 Tests
EUR 689.00

Human UPK2 shRNA Plasmid
20-abx955048
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UPK2 Rabbit pAb
A3338-100ul 100 ul
EUR 308.00

UPK2 Rabbit pAb
A3338-200ul 200 ul
EUR 459.00

UPK2 Rabbit pAb
A3338-20ul 20 ul Ask for price

UPK2 Rabbit pAb
A3338-50ul 50 ul Ask for price

UPK2 Rabbit pAb
A10813-100ul 100 ul
EUR 308.00

UPK2 Rabbit pAb
A10813-200ul 200 ul
EUR 459.00

UPK2 Rabbit pAb
A10813-20ul 20 ul
EUR 183.00

UPK2 Rabbit pAb
A10813-50ul 50 ul
EUR 223.00

UPK2 Polyclonal Antibody
27504-100ul 100ul
EUR 252.00

UPK2 Polyclonal Antibody
27504-50ul 50ul
EUR 187.00

UPK2 cloning plasmid
CSB-CL025656HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 555
  • Sequence: ATGGCACCCCTGCTGCCCATCCGGACCTTGCCCTTGATCCTGATTCTGCTGGCTCTGCTGTCCCCAGGGGCTGCAGACTTCAACATCTCAAGCCTCTCTGGTCTGCTGTCCCCGGCACTAACGGAGAGCCTGCTGGTTGCCTTGCCCCCCTGTCACCTCACAGGAGGCAATGCCAC
  • Show more
Description: A cloning plasmid for the UPK2 gene.

anti- UPK2 antibody
FNab09274 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IHC：1:20-1:200
  • Immunogen: uroplakin 2
  • Uniprot ID: O00526
  • Gene ID: 7379
  • Research Area: Developmental biology
Description: Antibody raised against UPK2

anti- UPK2 antibody
FNab09275 100µg
EUR 585.00
  • Recommended dilution: IHC：1:20-1:200
  • Immunogen: uroplakin 2
  • Uniprot ID: O00526
  • Gene ID: 7379
  • Research Area: Developmental biology
Description: Antibody raised against UPK2

Anti-UPK2 antibody
PAab09274 100 ug
EUR 386.00

Anti-UPK2 antibody
STJ112709 100 µl
EUR 277.00
Description: This gene encodes one of the proteins of the highly conserved urothelium-specific integral membrane proteins of the asymmetric unit membrane which forms urothelium apical plaques in mammals. The asymmetric unit membrane is believed to strengthen the urothelium by preventing cell rupture during bladder distention. The encoded protein is expressed in the peripheral blood of bladder cancer patients with transitional cell carcinomas.

Anti-UPK2 antibody
STJ26047 100 µl
EUR 277.00
Description: This gene encodes one of the proteins of the highly conserved urothelium-specific integral membrane proteins of the asymmetric unit membrane which forms urothelium apical plaques in mammals. The asymmetric unit membrane is believed to strengthen the urothelium by preventing cell rupture during bladder distention. The encoded protein is expressed in the peripheral blood of bladder cancer patients with transitional cell carcinomas.

UPK2 ORF Vector (Human) (pORF)
ORF014895 1.0 ug DNA
EUR 354.00

UPK2 Protein Vector (Human) (pPB-C-His)
PV059577 500 ng
EUR 481.00

UPK2 Protein Vector (Human) (pPB-N-His)
PV059578 500 ng
EUR 481.00

UPK2 Protein Vector (Human) (pPM-C-HA)
PV059579 500 ng
EUR 481.00

UPK2 Protein Vector (Human) (pPM-C-His)
PV059580 500 ng
EUR 481.00

Uroplakin-2 (UPK2) Antibody
20-abx126762
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Uroplakin 2 (UPK2) Antibody
20-abx116547
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Uroplakin-2 (UPK2) Antibody
abx239274-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

Uroplakin 2 (UPK2) Antibody
20-abx131673
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Uroplakin-2 (UPK2) Antibody
20-abx002383
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Mouse Uroplakin-2 (Upk2)
1-CSB-EP025656MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 40.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Uroplakin-2(Upk2) expressed in E.coli

UPK2 Polyclonal Conjugated Antibody
C27504 100ul
EUR 397.00

Human Uroplakin 2 (UPK2) ELISA Kit
20-abx156911
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Uroplakin- 2, UPK2 ELISA KIT
ELI-36740h 96 Tests
EUR 824.00

UPK2 sgRNA CRISPR Lentivector set (Human)
K2591901 3 x 1.0 ug
EUR 339.00

Human Uroplakin 2 (UPK2) CLIA Kit
20-abx494951
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Uroplakin 2 (UPK2) ELISA Kit
SEF561Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.50
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit
SEF561Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.30
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit
SEF561Hu-1x96wellstestplate 1x96-wells test plate
EUR 639.00
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit
SEF561Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.50
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit
4-SEF561Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Uroplakin 2 elisa. Alternative names of the recognized antigen: UPII
  • Uroplakin II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Uroplakin 2 (UPK2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human)
4-PAF561Hu01
  • EUR 261.00
  • EUR 2734.00
  • EUR 676.00
  • EUR 330.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2)

Human Uroplakin 2(UPK2)ELISA Kit
QY-E02051 96T
EUR 374.00

Human Uroplakin 2 ELISA Kit (UPK2)
RK02481 96 Tests
EUR 521.00

UPK2 Protein Vector (Rat) (pPB-C-His)
PV314586 500 ng
EUR 603.00

UPK2 Protein Vector (Rat) (pPB-N-His)
PV314587 500 ng
EUR 603.00

UPK2 Protein Vector (Rat) (pPM-C-HA)
PV314588 500 ng
EUR 603.00

UPK2 Protein Vector (Rat) (pPM-C-His)
PV314589 500 ng
EUR 603.00

UPK2 Protein Vector (Mouse) (pPB-C-His)
PV244278 500 ng
EUR 603.00

UPK2 Protein Vector (Mouse) (pPB-N-His)
PV244279 500 ng
EUR 603.00

UPK2 Protein Vector (Mouse) (pPM-C-HA)
PV244280 500 ng
EUR 603.00

UPK2 Protein Vector (Mouse) (pPM-C-His)
PV244281 500 ng
EUR 603.00

Uroplakin 2 (UPK2) Antibody (Cy3)
20-abx274287
  • EUR 592.00
  • EUR 286.00
  • EUR 1887.00
  • EUR 857.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.